MPMI PhytoFrontiers Phytobiomes all journals
DISEASE NOTESOpen Access icon OPENOpen Access license

First Report of Brome mosaic virus (BMV) and Wheat streak mosaic virus (WSMV) Co-infection in Triticale Plants in Poland

    Affiliations
    Authors and Affiliations
    • K. Trzmiel , Department of Virology and Bacteriology, Institute of Plant Protection-National Research Institute, 60-318 Poznań, Poland
    • W. Szydło , Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Faculty of Biology, Adam Mickiewicz University, 61-614 Poznań, Poland
    • A. Zarzyńska-Nowak
    • M. Jeżewska , Department of Virology and Bacteriology, Institute of Plant Protection-National Research Institute, 60-318 Poznań, Poland.

      Triticale (× Triticosecale Wittm. ex A. Camus) is one of the most important cereal crops in Poland. Stunted triticale plants, or plants with mild leaf mosaic symptoms were collected in research plots of the Plant Breeding Station in Szelejewo (Poland, the Wielkopolska region) July of 2013. DAS-ELISA (Double Antibody Sandwich Enzyme-linked Immunosorbent Assay) test (Loewe, Sauerlach, Germany) results confirmed Wheat streak mosaic virus (WSMV) infections in three of 32 symptomatic plants. These three infected plants exhibiting mild leaf mosaic were used for mechanical inoculation with 0.05 M phosphate buffer (pH 7.0) of wheat plants (Triticum aestivum L.) cv. Muszelka. Systemic leaf mosaic symptoms were visible after ca.15 days post inoculation. Electron microscopic observations of symptomatic plants revealed the presence of flexuous (∼700 nm long) and spherical (∼25-30 nm in diameter) virions in the plant sap. The virions dimensions suggested the coinfection WSMV with Brome mosaic virus (BMV). The final identification of viruses was confirmed by molecular methods. Total RNA was extracted with the NucleoSpinRNA Plant kit (Macherey-Nagel, Düren, Germany) according to the manufacturer’s protocol. Reverse transcription (RT)-PCR was performed with two sets of primers. BMVcp-F/BMVcp-R (GATCTATGTCCTAATTCAGCG/CCAGTCAGGGGCTCTCCGAGC) were designed to amplify the complete coding sequence of the coat protein (CP) on RNA3 of BMV and yielded an amplicon of 626 bp. WSMVCPeur-F/WSMVCP-R (ACCTAACTGGGAACCGAACWG/GTATTCCGCGTAGCCTGTTC) primers targeting the CP fragment of European isolates of WSMV amplified a 999-bp product. Specific products obtained for both viruses were purified, cloned into the pGEM-T Easy Vector (Promega, Madison, USA), and sequenced in both directions. The nucleotide sequences were analyzed using BLASTn program, compiled and edited in the BioEdit software (Hall 1999) and deposited as GenBank Accession Nos. KP096133 for BMV and KP261825 for WSMV. Nucleotide sequence of the Polish isolate of BMV (BMV-Sz) revealed 97% identity to the corresponding regions of the Russian isolate (J02042) and the Type isolate (×58459), and 95% identity to the Czech isolate BMV-Cz (GU584129). Similar analysis for the Polish isolate of WSMV (WSMV-Sz) showed 98% identity to the corresponding region of the French isolate WSMV-Marmagne (HG810953) and 97% identity with WSMV from Russia (AF455559), Czech Republic (AF 454454), Hungary (AF454456), and Germany (HG810954). Only 88% identity level was found with isolates from other parts of the world, e.g., WSMV-Sidney 81 (AF057533). These sequence similarities confirmed presence of BMV and WSMV in collected triticale plant samples. Single infections of BMV in wheat (Jeżewska and Wieczorek 1999) and WSMV in wheat, triticale, and maize (Zea mays L.) plants (Jeżewska 2000; Trzmiel and Szydło 2012) were identified in Poland by serological methods. To our knowledge, this is the first report of BMV in triticale in Poland and the first molecular identification of BMV/WSMV coinfection. BMV is transmitted mainly by beetles (several species of Oulema and Phylotrella genera) and WSMV is transmitted by the wheat curl mite (Aceria tosichella (Keifer)). The natural incidence of mixed infection of WSMV and BMV in triticale crops raises the question of their interactions and the possibility of transmission by a common vector. New vectors of BMV will be the subject of further research.

      References:

      The study co-funded by National Science Centre (Poland) grant no. DEC-2011/01/N/NZ8/04540).