MPMI PhytoFrontiers Phytobiomes all journals
DISEASE NOTESOpen Access icon OPENOpen Access license

First Report of the Root-Knot Nematode Meloidogyne enterolobii Infecting Jackfruit Tree in China

    Affiliations
    Authors and Affiliations
    • H. B. Long
    • Y. F. Sun
    • C. Bai , Environment and Plant Protection Institute, Chinese Academy of Tropical Agricultural Sciences, Haikou, Hainan 571101, China
    • D. L. Peng , State Key Laboratory for Biology of Plant Diseases and Insect Pest, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China.

      Jackfruit (Artocarpus heterophyllus Lam) is the largest tree fruit in the world and widely cultivated in the tropical regions of South and Southeast Asia. In September 2014, several jackfruit trees in an orchard in Wanning, Hainan Province, China were observed with symptoms of decline including wilting and trunk cracking. Partial roots of the affected trees (n = 12) were collected, and showed symptoms of root-knot nematode (Meloidogyne spp.) infection, were heavily galled, and were beginning to rot. Meloidogyne second stage juveniles (J2) were extracted from the rhizosphere soil of these symptomatic plants, and the population densities of J2s ranged from 250 to 810 per 200 cc soil. Species identification used a combination of morphology and morphometrics. The perineal patterns of most female specimens (n = 20) were oval shaped, with moderately high to high dorsal arch and mostly lacking obvious lateral lines. The J2 body length (n = 20) was averaged 430.8 ± 19.6 μm (407.0 to 461.9 μm) with a mean width of 15.6 ± 0.8 μm (14.3 to 16.9 μm); lateral lips were large and triangular in face view; stylet lengths were 11.7 ± 0.7 μm (10.7 to 12.8 μm); dorsal gland orifice from stylet base were 3.7 ± 0.3 μm (3.0 to 4.5 μm); tail was thin and length was averaged 54.7 ± 1.9 μm (47.5 to 60.2 μm), with a broad, bluntly rounded tip. The morphology of the perineal patterns and measurements of selected characters of J2 fit those of the original description for M. enterolobii (Yang and Eisenback 1983). For further confirmation, DNA was extracted from 10 single mature females and the mtDNA between COII and the lRNA gene was amplified with primers C2F3/1108 (GTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (Powers and Harris 1993). A 705-bp DNA fragment was obtained and the sequence (GenBank Accession No. KR064786) was 100% identical to the sequence of M. mayaguensis from the USA (AY446969), a synonym of M. enterolobii. Furthermore, species identification was also confirmed using PCR to amplify rDNA-IGS2 with M. enterolobii-specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). The electrophoresis results showed a bright band (∼200 bp) only in the lane with the M. enterolobii-specific primers. Its size was identical to those previously reported for M. enterolobii. Therefore, this population of Meloidogyne sp. isolated from jackfruit trees was identified to be M. enterolobii based upon morphological and molecular characteristics. Meloidogyne enterolobii is polyphagous and has a wide host range, including cover and vegetable crops, fruit trees, herbs, and ornamental and weed plants. Moreover, it displays virulence against several sources of Meloidogyne resistance genes and is considered particularly aggressive (Castagnone-Sereno 2002). To our knowledge, this is the first report worldwide of jackfruit as a host of M. enterolobii and the first record of M. enterolobii parasitizing a plant in the Artocarpus genus of the mulberry family (Moraceae) in China.

      References: