Rotting Grapes Don’t Improve with Age: Cluster Rot Disease Complexes, Management, and Future Prospects

Grape cluster rots are significant diseases of grapevines that have plagued growers for centuries (Steel et al. 2013). In the 1880s, black rot disease swept across the European countryside, ravaging vineyards in multiple growing regions. In its wake, the disease left innumerable small, hard, shriveled, mummified berry husks and caused the near collapse of the continental wine industry (Barnes 1979; Wilcox et al. 2015b). Today, in the United States, these grape rots continue to cost millions of dollars in yield losses to growers each year and extensive input costs are needed to manage them (Madden et al. 2017). Although there is abundant knowledge about managing certain rots such as Phomopsis fruit rot, black rot, and Botrytis bunch rot, other cluster rot disease complexes are still mysterious and understudied. Specifically, there is limited information about the particular pathogens at play, the environmental conditions conducive for disease, and the underlying mechanisms of pathogenicity (Hall et al. 2018a). Many cluster rots need interactions between multiple pathogenic microbes, susceptible cultivars, vectoring pests, and local weather conditions, creating a complex relationship. Understanding the interactions between these factors, or grape cluster rot disease ecology, is critical for creating and implementing effective field management practices, especially during the critical infection period (Fig. 1). Growers and researchers alike are interested in learning more about these disease complexes and strive to develop best practices to manage them in the field. This review article highlights some of the most common grape cluster rot complexes found in the United States. We describe the rots, starting with emergent early-season diseases (black rot, Phomopsis fruit rot, and bitter rot) followed by late-season diseases such as Botrytis bunch rot, ripe rot, and sour rot. We describe important insect pests and those that vector microbial pathogens, discuss current molecular diagnostics, and outline best management practices. Finally, we underscore important field management practices and discuss future prospects for understanding and managing resistance to grape cluster rots.

Download as PowerPoint

Black rot.

Black rot on grapevine is caused by the fungal pathogen Guignardia bidwellii (Ellis) Viala & Ravaz (anamorph: Phyllosticta ampelicida (Engelmann) van der Aa 1861). This grape pathogen is native to North America (Hoffman and Wilcox 2002) but has spread to Europe and South America since the end of the 19th century (Molitor and Beyer 2014). The disease is still expanding to new territories; for example, the first observation of black rot in China occurred in 2013 on Kyoho grape (V. labruscana hybrid) (Cui et al. 2015). As of 2015, G. bidwellii is considered a quarantine pathogen in Australia (Sosnowski et al. 2012). Crop losses between 5 and 80%, and up to 100%, can result without proper management of this disease (Molitor and Beyer 2014; Rinaldi et al. 2013; Wilcox et al. 2015b). In central Europe, disease severity of 0.8% was reported to be equivalent to the cost of the black rot fungicide spray regime (Molitor and Beyer 2014). Black rot is favored by warm weather but can be a significant threat in moderately temperate humid regions with late springs and summer rainfall (Spotts 1977). On berries, the first symptom appears as a cream-colored dot, which expands and develops an outer ring of light brown necrotic tissue; this brown necrotic area eventually overtakes the entire berry (Spotts 1980) (Fig. 2). Pycnidia can also be observed early in the infection; these small blue to black spots spread across the surface of the berry, sometimes in concentric rings. Once the entire berry has rotted, it darkens and shrivels into a hard, bluish-black mummy. G. bidwellii can overwinter in mummified berries, as well as in cane lesions, and produces both ascospores and conidia that continue the disease cycle (Becker and Pearson 1996; Hoffman and Wilcox 2002).

Download as PowerPoint

Although G. bidwellii (P. ampelicida) infection can result in symptoms similar to herbicide damage, fertilizer damage, or wilting and rotting caused by other fungi, the appearance of pycnidia on the shoot, leaf, or cluster lesions is characteristic of black rot (Molitor and Beyer 2014). However, because pycnidia are not always formed in warmer climates, this generalization can lead to incorrect field diagnosis (Molitor and Beyer 2014). Studies conducted in 2012 and 2013 have established a basis for molecular and proteomic (protein) identification for taxonomic purposes rather than detection (Molitor and Beyer 2014). Microsatellite markers have been used to detect and differentiate between G. bidwellii and Plasmopara viticola, the causal agent of downy mildew of grape, which can cooccur on grape (Molitor and Beyer 2014).

Berries infected near the end of their susceptible period may not dry out but growers may notice that they develop an unpleasant taste (Molitor et al. 2012). Fruit is most susceptible 3 to 5 weeks after bloom, and susceptibility decreases 6 to 7 weeks after bloom (Hoffman and Wilcox 2002). Although the pathogen can be controlled relatively easily with modern fungicides, it is a challenge in organic production when growing susceptible grape cultivars (Wilcox et al. 2015a). V. vinifera cultivars all appear to be highly susceptible to black rot (Wilcox et al. 2015a). Potential for black rot resistance was found in the hybrid cultivars ‘Felicia’, ‘Merzling’, and ‘Villard blanc’ in a 2012 study by F. Rex (Molitor and Beyer 2014).

Phomopsis fruit rot.

Another cluster rot disease with a wide geographic range is Phomopsis fruit rot, caused by Phomopsis viticola (Sacc.) Phomopsis (Sacc.) Bubák (teleomorph: Diaporthe Nitschke). The pathogen has historically been characterized by its host affiliation, although more than one Phomopsis sp. is sometimes found on a given host. Phomopsis spp. can be best identified by molecular methods, and phylogenies are available to resolve taxonomic issues (Gomes et al. 2013; Higgins et al. 2021; Úrbez-Torres et al. 2013). Phomopsis cane and leaf spot and fruit rot symptoms are small black lesions or spots that can appear on leaves and shoots (Fig. 2). Phomopsis rots occur later in the season, often after black rot appears on fruit, and can be diagnosed when fruit turn brown and become soft and shriveled. Additionally, the fruit will develop small, black, pepper-like fungal fruiting bodies on shriveled fruit (Savocchia et al. 2007). Although this disease occurs across the globe, it causes the most economic damage in temperate grape-growing regions (Anco et al. 2013; Pearson and Goheen 1988). P. viticola overwinters in the diseased tissues of the grape cane and is also a known trunk disease pathogen in some growing regions (Úrbez-Torres et al. 2013). During harvest time, necrosis of the grape berries and pycnidia can also be seen when infections are severe (Savocchia et al. 2007). Once spring arrives, the pycnidia produce conidia that are rain dispersed to infect new host tissue. Initial production of conidia is robust but decreases later in the growing season. Early-season management strategies include dormant cane applications, in-season fungicide applications, and removal of diseased canes through pruning (Nita et al. 2007; Pearson and Goheen 1988). Grape rachis and berries are susceptible to Phomopsis fruit rot the entire growing season and inoculum is continually available if environmental conditions are favorable (Anco et al. 2013; Erincik et al. 2001).

The effects of temperature and wetness on infection of P. viticola have been studied extensively (Bugaret 1984; Erincik et al. 2003). Optimum temperature for infection is between 23 and 25°C, and at least 4 h of wetness is required for infection (Bugaret 1984). The minimum and maximum temperatures for infection are 5 and 35.5°C, respectively (Erincik et al. 2003). Predictive models are currently available which estimate sporulation on canes as a way to understand how much inoculum is present to infect fruit; these models serve as a warning system and allow us to understand the P. viticola disease cycle (Anco et al. 2013).

Several studies have investigated whether fruit possess ontogenic resistance to P. viticola (Erincik et al. 2001; Gregory 1913; Lal and Arya 1982; Pscheidt and Pearson 1989). Although initial studies suggested that ontogenic resistance exists, follow-up studies showed that berry and rachis infections can occur at all growth stages between prebloom and véraison, with no evidence of decreasing susceptibility over time (Erincik et al. 2001).

Bitter rot.

Bitter rot is caused by the fungus by Greeneria uvicola Punith. (syn. Melanconium fuligineum). This disease persists in grape-growing regions with warm summer rains such as in the southeastern United States, coastal Australia, Greece, and parts of South America and Asia (Greer et al. 2014; Kummuang et al. 1996). Environmental conditions that are most favorable for this disease are subtropical with high rainfall and warm conditions which occur during the final stages of berry ripening (Steel et al. 2012). G. uvicola is a serious problem for many grape growers, with crop losses ranging from 10 to 50% (Longland and Sutton 2008; Steel et al. 2012). Although this fungus can infect detached fruit of hosts other than grape, it is not known to cause problems on horticultural plants other than grape (Steel et al. 2012).

V. vinifera are most susceptible to G. uvicola between véraison and harvest (Longland and Sutton 2008). G. uvicola can overwinter and live saprophytically on fallen fruit and necrotic bark; with the onset of spring, the fungus exudes conidia (Longland and Sutton 2008). Rain spreads the conidia to new areas of the vine, including pedicels, and in wet, warm conditions infection can occur, optimally at 22.4 to 24.6°C with 6- to 12-h periods of wetness (Longland and Sutton 2008). G. uvicola primarily attacks mature berries but has also been found to infect grapevine flowers and pedicels, where it remains latent until the berries begin ripening (Greer et al. 2014; Steel et al. 2012). Rain splash can cause secondary infections by moving conidia from infected berries to other fruit. Damaged berries tend to be more prone to infection, and symptoms include sunken, circular lesions on the berry (spots) (Fig. 2). A few resistant cultivars of grape exist: V. aestivalis ‘Cynthiana’ (syn. ‘Norton’) is highly resistant; French-American hybrids of V. vinifera are more resistant than V. vinifera cultivars; and V. vinifera ‘Merlot’, ‘Riesling’, and ‘Sauvignon Blanc’ are moderately resistant (Reisch et al. 1979; Wilcox et al. 2015a).

Bitter rot can concurrently occur with ripe rot (Colletotrichum spp.) in a vineyard, and even on the same cluster (Greer et al. 2011; Steel et al. 2012). The two are often confused because they tend to be favored by the same weather conditions. However, bitter rot is characterized by masses of acervuli, which can leave hands black when clusters are handled while wet, whereas ripe rot infection results in a slimy mass or dried crust of pink to salmon-colored spores (Wilcox et al. 2015a). In wine production, bitter rot results in bitter taints or off-flavors, whereas wine made from ripe-rot-affected grape has a musty aroma, comparable with a burlap sack, and higher glycerol, gluconic acid, and volatile acidity levels (Meunier and Steel 2009; Steel et al. 2012).

Botrytis bunch rot.

Botrytis cinerea Pers. (1794) is perhaps the most notorious of the rots and is found almost everywhere grapevines are grown. In grape, this necrotrophic fungal pathogen causes rot primarily in clusters and is a major issue in tight-clustered varieties. Signs and symptoms include sporulation and decomposition of berry tissue. B. cinerea has wide-scale economic importance, affecting over 200 host species, including grape, strawberry, tomato, and potato (Coley-Smith and Verhoeff 1980; Dean et al. 2012; Simionato et al. 2017). Interestingly, the majority of fungicides used to control this pathogen were developed specifically for grape disease management (Dean et al. 2012; Steiger 2007). Even though B. cinerea prefers wet conditions, it is fairly ubiquitous across the United States and the world (Karchani-Balma et al. 2008). B. cinerea has been found on plants on remote oceanic islands and even in microfungal communities collected from Antarctica (Azmi and Seppelt 1998; Garfinkel et al. 2019; Rodríguez et al. 2014).

Initial symptoms for grape are typically brown lesions on the berry skin and underlying mesocarp, causing discoloration on both tissue types (Fig. 2). As the disease progresses, masses of gray spores can be seen on the fruit (Oliveira et al. 2017; Sutton 1998). B. cinerea can infect grape directly through conidial germination and the grapevine flowers through mycelial penetration early in the growing season (Armijo et al. 2016; Viret et al. 2004). Often, the fungus remains dormant in the developing grape berry until the berries mature and soluble solids reach approximately 12 brix. Mature berries can be infected directly, typically through cracks or other wounds. Following infection, grape berries change metabolically and have increased production of gluconic acid and glycerol (Armijo et al. 2016). Abundant spore production and a polycyclic disease cycle make B. cinerea a challenging pathogen to manage (Fernández-Ortuño et al. 2012; Leroux et al. 2002). This is further compounded by a high risk of fungicide resistance development to commonly used fungicide classes. Management of Botrytis bunch rot relies on a single fungicide application at bloom, followed by leaf thinning around the cluster zone to improve airflow in hot and dry regions. In growing regions with high humidity, management may include additional sprays as clusters develop and ripen. Fungicide resistance is a primary factor in shaping Botrytis populations, and these populations can persist across years (DeLong et al. 2020; Fernández-Ortuño et al. 2015; Kozhar et al. 2020; Naegele et al. 2021). Hybrids of V. labrusca cultivars (e.g., ‘Isabella’) differ in their susceptibility to B. cinerea and cluster architecture plays a role in Botrytis bunch rot management. A positive correlation has been shown between B. cinerea incidence and severity and the degree of compactness of grape clusters (Bondada et al. 2016; Hed and Centinari 2021; Hed et al. 2009; Tello and Ibáñez 2018).

Interestingly, although both V. vinifera and Botrytis spp. originated in Eurasia, most V. vinifera cultivars have little or no resistance to Botrytis spp., and table grape varieties, with their thin berry skin, are more susceptible than wine grape (Gabler et al. 2003; Naegele 2018). Some wine grape cultivars with reduced susceptibility have been reported but, often, this is due to a loose, open cluster architecture that promotes epicuticular wax deposition on berries (Gabler et al. 2003; Kocsis et al. 2018; Marois et al. 1986; Richter et al. 2020; Vail and Marois 1991). In the vineyard, cultivars such as Cabernet Sauvignon and Petit Verdot have low observed disease incidence compared with tight-clustered cultivars such as Pinot Gris and Riesling (Paňitrur-De La Fuente et al. 2018; Vail and Marois 1991). In the lab, however, these cultivars had similar levels of susceptibility to B. cinerea. Wild Vitis spp., including V. cinerea, V. rotundifolia, and V. labrusca, have some degree of resistance, and have been used to generate resistant interspecific hybrids (Eibach and Töpher 2003; Pedneault and Provost 2016; Reisch et al. 2014; Wan et al. 2015). Several resistant wine grape hybrid cultivars are widely grown, including Regent (Germany) and Frontenac (northern United States) (Atucha et al. 2018; Migicovsky et al. 2016). For most susceptible grape cultivars, chemical management can minimize disease severity. Increasing air flow in and around the clusters through manual leaf thinning or chemical applications of DL-β-amino-n-butyric acid can effectively reduce cluster rot incidence in the vineyard although, over time, these practices can lead to resistance (English et al. 1990; Hed and Centinari 2021; Kocsis et al. 2018). Timing and amount of leaf removal is critical because it can affect berry set and yield, in addition to cluster compactness and disease severity (Molitor et al. 2011, 2012; Mosetti et al. 2016; Würz et al. 2020; Zoecklein et al. 1992). When leaf removal occurs after véraison, little effect on disease severity is observed because infection typically takes place during bloom.

Ripe rot.

Ripe rot occurs in subtropical viticulture regions worldwide, including Australia (Greer et al. 2014; Meunier and Steel 2009), India, Asia, (Steel et al. 2013), and Brazil (Echeverrigaray et al. 2020). This widespread disease was originally thought to be caused by Colletotrichum gloeosporioides sensu lato and C. acutatum sensu lato.

Identification of Colletotrichum spp. originally relied on conidia shape and size, colony morphology, host plant, and other characteristics and physiological traits. However, more recent molecular identification techniques have identified additional Colletotrichum spp. that are involved in the disease, including C. fructicola, C. kahawae, C. limitticola, C. nymphaeae, C. karstii, and C. viniferum (Echeverrigaray et al. 2020; Oo and Oh 2017). Different species within this pathogen complex displayed varying amounts of virulence on their grape hosts, and those with low virulence were found less frequently on the grape (Echeverrigaray et al. 2020). For the first time, a gene region in the grapevine genome was discovered to confer resistance to ripe rot, which will help breeders design host resistance genotypes in the future (Fu et al. 2019).

Ripe rot (Colletotrichum spp.) was first reported in the United States in 1891, and can be found primarily in warm and moist growing regions in the southeastern United States (Steel et al. 2013; Wilcox et al. 2015a). Although grape berries are susceptible to ripe rot from bloom to ripening, the disease appears most often during postvéraison and close to the point of berry maturity (Echeverrigaray et al. 2020). Symptoms begin with circular, reddish-brown spots of decay on the skin of affected berries; the spots eventually enlarge to include the entire berry (Fig. 2). As the berry further decays, salmon-colored masses of conidia form. Eventually, diseased berries shrivel and die; at this point, symptoms may resemble a number of other rots, including black rot, bitter rot, and Phomopsis fruit rot (Wilcox et al. 2015a). Ripe rot is not the same as anthracnose of grape (Elsinoë ampelina) but they are sometimes confused because diseases incited by Colletotrichum spp. are given the common name anthracnose on many other crops (Wilcox et al. 2015a).

Sour rot and summer bunch rot.

Sour rot is a disease complex in temperate grape-growing regions involving acetic acid bacteria, various yeasts, Drosophila fruit flies, and the grape host. This disease complex is still poorly defined; however, it is known that yeast infection occurs first, converting sugars in the grape to ethanol. Following the yeast infection, acetic acid bacteria in the berry juices oxidize the alcohol into acetic acid, which gives the disease its distinctive vinegar-like smell along with browning of the berry skin (Fig. 2) (Hall et al. 2018a). As the berries rot, volatiles that attract insects are produced that facilitate disease progression and spread. Drosophila fruit flies, the main insects associated with the sour rot disease complex, carry the yeasts and acetic acid bacteria on their bodies and in their guts, and can transfer them to the berries as they feed or lay their eggs. Late in the growing season, cracks in the berry skin, caused by biotic and abiotic factors, create entry points for the microbes on the flies to disperse to the berry (Kenney and Hall 2021). Social wasps may also play a role in sour rot ecology (Madden et al. 2017). Disease management trials indicated that the most impactful way to manage sour rot was to use insecticides in tandem with antimicrobial applications in order to manage these two aspects of the disease complex (Hall et al. 2018a). In a more holistic approach to sour rot management, cultural controls such as canopy training systems can be utilized. Canopies that were trained to vertical shoot positioning also exhibited significantly less sour rot severity than those trained to a high wire cordon system (Hall et al. 2018b) (Fig. 3). Other approaches include using gibberellic acid (GA) to loosen clusters and, thereby, reduce disease in other bunch rots (Hed et al. 2009) (Fig. 4).

Download as PowerPoint

Download as PowerPoint

Summer bunch rot is caused by a collection of microbes, resulting in symptoms similar to those of sour rot. However, it is not understood if the microbial community composition of summer bunch rot disease complex is similar to that of the sour rot disease complex (UC IPM 2017) (Table 1). Summer bunch rot is often described as synonymous with sour rot (Pisani et al. 2015; Rooney-Latham et al. 2008) or, sometimes, sour rot is referred to as a principal component of the summer bunch rot complex (Duncan et al. 1995; Stapleton 1992). An older definition describes summer bunch rot as a specific type of sour rot caused by initial infection of Diplodia natalensis Pole-Evans (syn, Lasiodiplodia theobromae (Pat.) Griffon & Maubl and Botryodiplodia theobromae Pat., teleomorph, Botryosphaeria rhodina (Cooke) Arx); however, this is primarily based on a summer bunch rot complex that affected ‘Thompson Seedless’ grape in the San Joaquin and Coachella Valleys of California in the 1960s (Hewitt 1974, 1979). Later observations in the same area did not recover any D. natalensis (Duncan et al. 1995) but, instead, found Aspergillus niger and A. carbonarius to be the primary pathogens associated with affected berries (Rooney-Latham et al. 2008). Both A. niger and A. carbonarius produce the mycotoxin ochratoxin A (OTA), which is carcinogenic, immunosuppressive, teratogenic, and nephrotoxic in animals (Pfliegler et al. 2020; Zhang et al. 2017). Due to the toxicity of OTA, the allowable concentration is limited to 2.0 μg/liter in juice, musk, and wine production and <10 μg/kg in dried fruit (Zhang et al. 2017). Volatile organic compounds (VOCs), including ketones, transnerolidol, and C-8 alcohols, are often associated with OTA synthesis in A. carbonarius (Zhang et al. 2017). VOC profiles or patterns can be used to predict OTA accumulation (Zhang et al. 2017) or even to differentiate between different bunch rot pathogens in grape juice production (Steel et al. 2013).

Table 1. Common fungi and bacteria associated in the grape sour rot disease complex^a

Scientific name	Microbe	Source	Ecological role or function	Reference
Aspergillus niger	Fungus	Inoculum	Most abundant type of A. niger associated with sour rot; produces ochratoxin A	Hall et al. 2018a; Tjamos et al. 2004
Hanseniaspora uvarum	Fungus	Inoculum	Ascomycete involved in fermentation	Barata et al. 2012b; Hall et al. 2018a
Pichia kluyveri	Fungus	Inoculum	Weakly fermentative yeast	Barata et al. 2008; Hall et al. 2018a
Saccharomyces cerevisiae	Fungus	Inoculum	Fermentative species that increases in abundance when grape skin is damaged	Barata et al. 2008; Hall et al. 2018a
Saccharomyces sp.	Fungus	Sequencing	Fermentative species that increases in abundance when grape skin is damaged	Barata et al. 2008; Hall et al. 2018a
Metschnikowia sp.	Fungus	Sequencing	Present as an endophyte in healthy grape berries	Hall and Wilcox 2019; Hall et al. 2018a
Gluconobacter sp.	Bacterium	Inoculum and sequencing	Present as an endophyte in healthy grape berries	Hall and Wilcox 2019; Hall et al. 2018a
Acetobacter aceti	Bacterium	Inoculum	Acetic acid bacteria present in sour rotten grape	Barata et al. 2012a; Hall et. al 2018a
Hafnia sp.	Bacterium	Sequencing	Bacteria associated with grapevines, especially the rhizosphere	Hall et al. 2018a; Karagöz et al. 2012
Rahnella sp.	Bacterium	Sequencing	Endophyte on grape	Hall et al. 2018a; Pacifico et al. 2019

^a Microbes labeled as “Inoculum” were used in the Hall et al. (2018a) article as sources of inoculum in pathogenicity experiments and those labeled as the same authors identified microbes through “Sequencing” by using amplicon-based next-generation genetic data taken from field samples.

View as image HTML

Molecular diagnostics.

Traditional diagnosis of cluster rots is typically done visually by symptoms alone (Figs. 1 and 2). However, a variety of molecular diagnostic techniques are available for cluster rot diseases of grape and can be useful for early disease detection. Although there are several primary pathogens, grape berries are a complex substrate and there are several known secondary colonizers such as Cladosporium cladosporioides, C. herbarum, Penicillium spp., Rhizopus arrhizus, and Alternaria spp. For the primary pathogens, most of these techniques are based on PCR and utilize a variety of unique loci (Table 2). Botrytis cinerea has the most extensive suite of marker systems and the majority of markers target various transposons (Martinez et al. 2008) (Table 2). Other marker systems target the internal transcribed spacer gene region, β-tubulin, or calmodulin genes (Samuelian et al. 2011). Sour rot is more complex and no known marker systems exist for the causal agents; an amplicon sequencing approach is required for both the yeast and the bacterial portions of the disease complex (Hall et al. 2018a).

Table 2. Molecular diagnostic markers to detect cluster rot pathogens in vineyards

Cluster rot disease, pathogens	Type of assay	Target locusa	Primers	Sequences (5′ to 3′)	References
Botrytis bunch rot, Botrytis cinerea	PCR	Flipper transposase gene	FLIP and FLIP 2	GGACCACCCCTCTTTTGGAC and CGGTTGTGTAAAGTGGTGCG	Duan et al. 2014; Martinez et al. 2008; Si Ammour et al. 2019; Suarez et al. 2005
	−	Insertion site of Flipper	FLIP2 and FABR	CGGTTGTGTAAAGTGGTGCG and GTGCCACCTAAGTTGAGTACCCC	−
	−	Boty transposon	BOT1 and BOT2	AGCCAAGGGCTCAAGATGA and TACGCTCGTTGTGGTGAAGT	−
	−	β-Tubulin gene	Bc1F and Bc1R	GTTACTTGACATGCTCTGCCATT and CACGGCTACAGAAA GTTAGTTTCTACAA	−
	−	SCAR marker	Bc2F and Bc2R	TTCGTGATTATCACCTGGGTTG and GCTCCTAGAACGTACGACCACA	−
	−	GS spacer	Bc3 and Bc3R	FGCTGTAATTTCAATGTGCAGAATCCI and GGAGCAACAATTAATCGCATTTC	−
	−	Cutinase-A gene	CG11d and CG12d	AGCCTTATGTCCCTTCCCTTG and GAAGAGAAATGGAAAATGGTGAG	−
	−	Initiate LAMP reaction	F3 and B3	CTACACAACGACCACAGT and CCACCAGGTAGTTTCAATCC	−
	−	Bcos5 gene	P1 and P2	GATACCCCTCAACAAAAGCCT and CCAGGTTGTCTTCCTACTTGC	−
	−	IGS	Bc3F and Bc3R	GCTGTAATTTCAATGTGCAGAATCC and GGAGCAACAATTAATCGCATTTC	−
Sour rot, acetic acid bacteria; yeasts	Amplicon sequencing	V4 region 16s rRNA	F515 and R806	GTGTGCCAGCMGCCGCGGTAA and GGACTACHVGGGTWTCTAAT	Bokulich et al. 2014; Hall et al. 2018a
	−	ITS 1	BITS and B58S3	CTACCTGCGGARGGATCA and GAGATCCRTTGYTRAAAGTT	−
Black rot, Guignardia bidwellii	PCR	ITS1-ITS2 region	ITS 4 and ITS 5	TCCTCCGCTTATTGATATGC and GGAAGTAAAAGTCGTAACAAGG	Donaldson 1995; Glass and O’Donnell and Whiteley 1999; Rinaldi et al. 2017; White et al. 1990
	−	β-Tubulin gene	Bt2a and Bt2b	GGTAACCAAATCGGTGCTGCTTTC and ACCCTCAGTGTAGTGACCCTTGGC	−
	−	Calmodulin gene	CL1 and CL2A	GA(GA)T(AT)CAAGGAGGCCTTCTC and TTTTTGCATCATGAGTTGGAC	−
Bitter rot, Greeneria uvicola	Real-time PCR	ITS region	GuF2b and GuR2	TCTGAACGTATCTCTTCTGAG and TAAGTCAACCTAAGCGAGAAG	Samuelian et al. 2011
Ripe rot, Colletotrichum spp.	Real-time PCR	ITS region	CaITS_F701 and CaITS_R699	GGATCATTACTGAGTTACCGC and GCCCGCGAGAGGCTTC	Debode et al. 2009; Samuelian et al. 2011
Phomopsis fruit rot, Phomopsis viticola	PCR	EF1-α gene	EF1-728F and EF1-986R	CATCGAGAAGTTCGAGAAGG and TACTTGAAGGAACCCTTACC	Schilder et al. 2005
	−	Calmodulin gene	CAL-228F and CAL-737R	GAGTTCAAGGAGGCCTTCTCCC and CATCTTTCTGGCCATCATGG	−

^a SCAR = sequence-characterized amplified region, LAMP = loop-mediated isothermal PCR, IGS = integrated genome sizing, ITS = internal transcribed spacer, and EF1 = elongation factor 1.

View as image HTML

Grape berries are a complex and ephemeral substrate for pathogens to colonize and on which to reproduce. The particular pathogen that can predominate on the fruit varies depending on cluster architecture and other ecological factors (moisture levels, temperature, and solar radiation). The major challenges in applying molecular diagnostic tools are generally getting clean DNA in adequate amounts to detect the pathogen and determining the best way to collect samples. The presence of PCR inhibitors in fruit (e.g., polyphenols and sugars) can complicate pathogen detection by reducing amplification efficiency or preventing amplification entirely (Salzman et al. 1999). These tools find utility in early prevention or detection of latent infections but may become most important when conducting spore-trapping experiments. In vineyards, a number of spore-trapping studies have been performed to monitor powdery mildew (Thiessen et al. 2016); in time, this technology could be utilized for cluster rot pathogens.

Best management practices for disease.

One of the main goals for managing cluster rot diseases is to minimize injuries to berries that enable pathogens to establish. Reducing the number of berries per cluster on tight-clustered varieties (Fig. 4) can be done mechanically but may be labor intensive. In addition, effective management of insects (e.g., grape berry moth, vespids, and other insects), birds, and powdery mildew will greatly reduce the risk of cluster rot in many vineyards. Promoting air circulation within the grapevine canopy also reduces the risk of cluster rots (Alzohairy and Miles 2020). Canopy management methods aimed at improving air circulation and reducing humidity include leaf removal in the fruit zone, shoot positioning, shoot thinning, and hedging. Limiting excessive vegetative growth by balance pruning and avoiding excess nitrogen fertilization can reduce disease; however, this may not always stave off cluster rot onset. Other in-season practices that limit canopy growth include promoting an optimal balance of light and shade and avoiding excessive shade that can encourage growth of fungal pathogens such as B. cinerea (Gubler et al. 1987; Smart et al. 1990).

Despite all of these cultural tools, chemical options are still critical to control cluster rot diseases. Multisite fungicides can be effective but are generally only moderate in their efficacy; thus, vineyard managers are forced to use site-specific products. Site-specific fungicides in Fungicide Resistance Action Committee (FRAC) codes 2, 7, 9, 11, 12, and 17 are effective on some cluster rot pathogens such as B. cinerea (Table 3). For early-season rots such as black rot and Phomopsis fruit rot, fungicides in FRAC codes 3 and 11, as well as ethylene bisdithiocarbamates, are the most effective. Generally, these management strategies are not effective for sour rot control; sterilants such as hydrogen peroxide and peroxyacetic acid are used commercially (Van Timmeren et al. 2019) and are applied in addition to insecticides (Gillett et al. 2018). Unfortunately, fungicide resistance is a worsening problem for controlling cluster rot diseases, particularly Botrytis bunch rot. For example, a recent study found that B. cinerea isolates recovered from Michigan vineyards were resistant to six of the eight major FRAC codes used to control B. cinerea (Alzohairy et al. 2021).

Table 3. Efficacious site-specific fungicides commonly used to control Botrytis cinerea in vineyards and resistance mechanisms that have been characterized

Active ingredient	Target site of action	FRAC codea	Resistance reported?	Mechanism of resistance	References
Thiophanate-methyl	β-tubulin assembly in mitosis	1	Yes	Amino acid substitutions in β-tubulin gene at locations 198 and 200	Fernández-Ortuño et al. 2015
Iprodione	NADH cytochrome c reductase in lipid peroxidation	2	Yes	Amino acid substitutions of Bos1 gene at locations 365 and 369, and other point mutations and rearrangements a part of multiple drug resistance and potentially unknown mechanisms	Fernández-Ortuño et al. 2015; Grabke et al. 2014
Boscalid, fluopyram, fluxapyroxad, isofetamid, penthiopyrad, pydiflumetofen, pyraziflumid	Complex II: succinate-dehydrogenase	7	Yes	Amino acid substitutions succinate dehydrogenase subunit B at locations 225, 230, and 272	Alzohairy et al. 2021; Samaras et al. 2016
Cyprodinil	Methionine biosynthesis	9	Yes	Mutations of Bos1 gene and other point mutations and rearrangements a part of multiple drug resistance	Alzohairy et al. 2021; Kretschmer et al. 2009; Saito et al. 2019
Azoxystrobin, kresoxim-methyl, mandestrobin, pyraclostrobin, trifloxystrobin	Complex III: cytochrome bc1	11	Yes	Amino acid substitution in cytb gene known as G143A complicated by presence of an intron	Alzohairy et al. 2021; Saito et al. 2016; Samuel et al. 2011
Fludioxonil	MAP/histidine-kinase in osmotic signal transduction	12	Yes	Mutations of Bos1 gene and other point mutations and rearrangements a part of multiple drug resistance	Fillinger et al. 2012; Kretschmer et al. 2009; Ren et al. 2016
Fenhexamid	3-Keto reductase, C4-de-methylation	17	Yes	Amino acid substitutions in erg27 gene at locations 63 and 412	Alzohairy et al. 2021; Fernández-Ortuño et al. 2015

^a Fungicide Resistance Action Committee.

View as image HTML

Insect pest management for late season cluster rots.

The development of cluster rot often involves the interplay of multiple organisms, and insects play a critical role. Insects can serve as pathogen vectors, facilitating the colonization of microorganisms by injuring or damaging the berries, or may contribute to the microbial community found in diseased clusters (Barata et al. 2012b; Entling and Hoffmann 2019; Fermaud and Le Menn 1992; Hall et al. 2018a; Ioriatti et al. 2018). Vineyard insects appear to have a close association with the development of sour rot and the transmission of Botrytis bunch rot (Fermaud and Le Menn 1992; Hall et al. 2018a). Grape sour rot does not develop typical symptoms without Drosophila fruit flies (Hall et al. 2018a). These flies play a critical role as vectors and contribute significantly to the development of the disease through their feeding activity (Entling and Hoffmann 2019; Hall et al. 2018a). The microbiome of Drosophila melanogaster contains both bacteria and yeast that contribute to sour-rot infection; however, these microorganisms seem to be unable to reproduce sour-rot symptoms individually. In fact, the microbial agents associated with sour rot seem to live as endophytes and epiphytes on the surface of healthy berries (Hall et al. 2019). Full development of the disease seems to require the presence of Drosophila flies (Hall et al. 2018a). Berry injury by feeding larvae and possible insect salivary or digestive enzymes is critical for the development of symptoms (Hall et al. 2018a). However, D. melanogaster oviposition on grape is limited to overripe or physically damaged berries (Rombaut et al. 2017). Drosophila infestations are often seen in berries previously wounded by other animals or cracked by changes in moisture (Entling and Hoffmann 2019). In contrast, the invasive species D. suzukii has the ability to infest fresh, healthy berries due to the presence of a special serrated ovipositor (Atallah et al. 2014). In field conditions, both Drosophila spp. are commonly present in sour rot-infected grape (Rombaut et al. 2017). Both D. melanogaster and D. suzukii harbor microbes associated with sour rot but only D. suzukii is able to wound unripe berries, whereas D. melanogaster appears late in the season in overripe wounded berries. It is speculated that initial infestations of D. suzukii may enhance sour rot infections by providing oviposition substrates for D. melanogaster later in the growing season (Rombaut et al. 2017). Entling and Hoffmann (2019) investigated the individual and joint effects of D. suzukii and D. melanogaster infestation on sour rot development. The authors concluded that both fly species contribute to the development of the disease but no synergistic effect was found (Entling and Hoffmann 2019). Similar to Drosophila, it appears that paper wasps harbor some of the sour-rot-associated microbes; the wasps are not able to physically injure the berries but can vector these microorganisms during their foraging behavior (Madden et al. 2017). The underlying mechanisms of sour rot association with drosophilid insects and paper wasps is not well understood. It is likely that the chemical composition of diseased clusters recruits fruit flies that are attracted to acetic acid and ethanol odors (Barata et al. 2012b; Giang et al. 2017) (Fig. 5) Additionally, sour-rot-infected grape may be a more nutritious food source for Drosophila than healthy berries. Free-living yeasts constitute a rich protein source for many species of Drosophila, and their concentration affects the survivorship of the larvae (Lewis and Hamby 2019). Rombaut et al. (2017) reported an increase in oviposition of D. melanogaster in sour-rot-infested grape compared with healthy ones. Therefore, the close association of Drosophila fruit flies with sour rot may represent a mutualistic relationship in which the flies contribute to the dispersion of the microbes which, in turn, enhance the survival of the flies (Barata et al. 2012b).

Download as PowerPoint

Control of Drosophila fruit flies is key in sour rot management programs because insect pests play a large role in disease development (Hall et al. 2018a). Drosophila flies are a problem late in the growing season and are controlled mainly with insecticides. Some insecticide sprays targeting Drosophila flies reduce sour rot severity; in a recent study, weekly applications of insecticides combined with antimicrobials reduced sour rot severity by 64% compared with untreated vines (Hall et al. 2018b). Spray programs should rotate products with different modes of action to avoid or delay the development of resistance. D. melanogaster has developed resistance to pyrethroid, organophosphate, and neonicotinoid insecticides (Sun et al. 2019). Cultural practices such as rigorous vineyard sanitation, mass trapping, and exclusion netting seem to help reduce populations of Drosophila (Ebbenga et al. 2019; Haye et al. 2016). Berry skin thickness affects the capability of D. suzukii to oviposit in grape berries; there seems to be a negative correlation between the number of eggs laid and berry skin resistance in different grape cultivars (Entling et al. 2019).

Various species of Lepidoptera moths from the family Tortricidae also appear to be associated with cluster rot diseases. Tortricid moths lay their eggs on grape berries or flowers; after hatching, the larvae feed on developing fruit (Gilligan et al. 2011). Developing larvae often move within the cluster, inflicting wounds on several berries. The physical damage facilitates pathogen infection, and the movement of the larvae enhances the possibility of transporting pathogens from diseased berries to healthy ones. Studies with the European grapevine moth (Lobesia botrana) demonstrated colonization by B. cinerea of larval wounds and at the entrance of larval galleries (Fermaud and Le Menn 1992). Larvae of L. botrana artificially contaminated with B. cinerea carried the pathogen and inoculated the walls of larval galleries (Fermaud and Le Menn 1992). These results suggest that cluster infestations with tortricid larvae may increase the incidence and severity of Botrytis bunch rot.

Future prospects.

Although cluster rots have plagued growers for centuries, some strategies for improving their management have emerged. Here, we highlight some promising opportunities for grape cluster rot management: (i) focused development on new and better cultural controls, (ii) refining and implementing detection technologies such as remote sensing and spore traps in vineyards for rapid and early disease detection, (iii) harnessing the power of gene editing and microbiome datasets and, finally, (iv) using additional ecological information to formulate targeted disease control interventions.

First, there is an urgent need to develop new and better cultural controls to combat grape diseases, especially for cluster rot management. Given that high moisture and warm temperatures play a role in disease progression, encouraging airflow can help manage disease, especially in tight-clustered varietals (Hed et al. 2009). Leaf canopy pruning promotes better air circulation and allows more sunlight, which can help reduce disease pressure for fungal and oomycete diseases powdery mildews and downy mildews, including cluster rots (Hickey and Hatch 2018). It is also possible to manipulate the grape cluster architecture to promote more airflow and dryness. Plant hormonal sprays induce cluster openness by changing the overall shape and number of grape per cluster (Hed et al. 2011). For instance, the plant hormone GA can modulate grape cluster compactness and reduce incidence and severity of cluster rots. A common method to induce GA production naturally, especially in table grape, is physical girdling of the trunk, which allows for cluster elongation. Girdling can result in cluster openness (Abu-Zahra and Salameh 2012) and can improve berry weight and sugar content by increasing plant stomatal conductance (Pereira et al. 2020); however, it could cause problems with trunk infections. In a study by Hed et al. (2011) and Hed and Centinari (2021), GA sprays were added to ‘Vignoles’ and ‘Chardonnay’ wine grape in vineyards in the eastern United States. When this hormonal spray was used, disease incidence was reduced by 40 to 50% for Botrytis bunch rot compared with clusters that were not sprayed. Spraying the correct amount of hormone at the right time (typically prebloom) is critical because it can negatively affect grape yield; this method still needs more research, especially in different microclimates. Moreover, spraying GA and other plant hormones that change the cluster phenotype is still not approved for most cultivars, and the brands that are approved for use vary between states and growing regions (B. Hed, personal communication). There is a tradeoff between the amount of spray used and the negative effects on vine and cluster growth and structure if used improperly. Still, growers are interested in these hormonal sprays as a promising strategy to loosen cluster architecture and suppress cluster rot development (Hed et al. 2011). Selection for cultivars with thicker cuticles appears to contribute some degree of resistance against infections from B. cinerea and seems to enhance resistance against sour rot (Entling and Hoffmann 2019; Gabler et al. 2003). Moreover, it has been reported that grapevines sprayed with silicon had less severe powdery mildew (Bowen et al. 1992; Reynolds et al. 1996) but there is no report of silicon increasing plant resistance to grape rots.

Second, plant disease detection technologies such as remote sensing and new and improved spore traps can be used in vineyards to rapidly find disease, especially when time and resources are limited. Remote sensing has traditionally been used to aerially map changes in Earth’s vegetation; however, more recently, it is being applied to the field of plant pathology to detect abiotic and biotic plant stress (Mahlein 2016). Images taken from airplanes or drones allow researchers to detect “hot spots” in a vineyard or locations where changes in foliage functional chemistry and reflectance indicate disease. The map that is generated can inform growers where to target on-the-ground scouting efforts for finding disease and where to sample vines to verify disease using molecular DNA identification (Zarco-Tejada et al. 2018). Although spectroscopy imaging technology for plant disease detection is still a burgeoning field, it has been used for rapid detection of Xylella fastidiosa in olive trees (Zarco-Tejada et al. 2018) and holds promise for diseases of grape.

Spore traps are another technology that has evolved to be more efficient and specific for disease detection. Many spore traps can stay in the field longer with better batteries and solar cells and they have increased their efficiency to collect airborne inoculum (Thiessen et al. 2016). These traps have the potential to improve inoculum models and refine disease forecasting systems. Furthermore, these technological advancements allow spore traps to collect plant pathogens with better accuracy and precision for microscopy analysis of spore identification and counts, as well as for downstream DNA amplification via PCR and high-throughput sequencing to assess aerial microbiota to detect potential pathogens (Crandall et al. 2020) or detect fungicide resistance (Miles et al. 2021).

Third, genetic tools can be used for cluster rot management and to determine indicators and biocontrol agents. As countries enact stricter fungicide restrictions, the need for cluster-rot-resistant grape cultivars will grow. Marker-assisted selection for grape breeding has been underway for certain fungal pathogens such as powder mildews (Dalbó et al. 2001) and other recent technologies such as embryo rescue are leading to new disease-resistant cultivars (Li et al. 2020). CRISPR gene editing is being developed for grape and could be a promising alternative or supplement to traditional breeding methods (Maher et al. 2019) (Figs. 6 and 7). Historically, traditional breeding of new disease-resistant grape varieties using wild ancestors has met resistance from industry and consumers alike, because of reported poor wine quality and “off flavors” (González-Centeno et al. 2019). The problems may be less likely in a CRISPR-edited grape as compared with wild material, because they would not be introgressed as in traditional breeding approaches. However, as consumer acceptance of blended bulk wines increases and the quality of hybrid wines continues to improve, new hybrid disease-resistant cultivars are becoming available (González-Centeno et al. 2019). This is evident in the release and widespread interest in powdery-mildew-resistant grape cultivars (Fuller et al. 2014; González-Centeno et al. 2019). Their widespread use will likely be dependent on disease pressure for a given region, and the cost and availability of cultural or chemical controls to manage disease (Sambucci et al. 2019).

Download as PowerPoint

Download as PowerPoint

Fourth, because cluster rots are complexes of pathogens, other microbes, and insect vectors that attack the grape berry, a better understanding of cluster rot ecology—specifically, the composition, structure, and function of the microbial communities that cause disease—is essential for developing targeted fungicides and management. Currently, pesticides are applied in two phases: early season (1 to 4 weeks after bloom) and late season (bloom to harvest). In the case of Phomopsis cane and leaf spot, azoxystrobin and captan are typically applied. For black rot, azoxystrobin, tebuconazole, and trifloxystrobin are applied (Todaro and Miles 2018). Finally, some pioneering microbiome studies have sought to identify the surface microbiome of healthy grape berries (Zhu et al. 2021) and the players in cluster rot interactions (Carmichael et al. 2019; Hall et al. 2019). Nevertheless, there remains enormous potential to screen the fruit microbiome for beneficial microbes that suppress disease on the grape berry surface and to understand the environmental cues that influence the epidemiology of these disease complexes (Hall et al. 2018a).

Acknowledgments

We thank the grape growers who allowed access to fields for photographing these various cluster rots.