First Report of Mixed Infection of Cassava Brown Streak Virus and Ugandan Cassava Brown Streak Virus on Cassava in North-eastern Democratic Republic of Congo

Cassava brown streak disease (CBSD), caused by two viruses (cassava brown streak virus [CBSV] and Ugandan cassava brown streak virus [UCBSV]), is one of the most important diseases affecting cassava in East and Central Africa. The viruses are spread through infected stem cuttings and by the whitefly Bemisia tabaci. Recognized from coastal East Africa since the 1930s, it is only in recent years that outbreaks have occurred in higher altitude areas of the African Great Lakes region (Legg et al. 2011). CBSD caused by UCBSV was officially reported for the first time from eastern Democratic Republic of Congo (DRC) in Nord-Kivu Province by Mulimbi et al. (2012). Eastern DRC is on the “front” of the westward-spreading pandemic of CBSD, and it is vital to understand the identity and epidemiology of viruses associated with this outbreak. If CBSV was to be reported from DRC, this increased diversity of CBSD-causing viruses would increase the threat posed by the disease and make management more difficult. In November 2016, cassava fields were inspected in Ituri Province, northeastern DRC. Fields were selected at 10- to 20-km intervals in the surveyed area. A total of 360 (10 per field) leaf samples were collected from 36 fields and dried in a herbarium press. Total RNA was isolated using an optimized cetyltrimethylammonium bromide method optimized for cassava (Abarshi et al. 2010) and subsequently analyzed with primers CBSV10-for (ATCAGAATAGTGTGACTGCTGG) and CBSV11-rev (CCACATTATTATCGTCACCAGG) (Monger et al. 2001) through standard reverse transcription polymerase chain reaction (PCR) amplification at International Institute of Tropical Agriculture (IITA)-Kalambo molecular biology laboratory. CBSV- and UCBSV-specific real-time PCR TaqMan assays (Adams et al. 2013) were performed at IITA-Tanzania for a subset of samples to identify the species associated with the infections. Root necrosis and leaf symptoms consistent with CBSD were observed during field inspections in the two territories respectively on the Nyagota cultivar in Djegu, Mahagi Territory (2.224°S, 31.166°E), and Sawasawa cultivar in Alivu-Amaguna, Aru Territory (3.023°S, 30.746°E). CBSD was also recorded in four other Mahagi and five Aru villages on both local and improved varieties. Eleven of the 36 fields were affected by CBSD, and average incidence in affected fields was 90.3%. Of the 360 leaf samples, 108 tested positive for cassava brown streak ipomoviruses (CBSIs). Species-level identifications using real-time PCR, made on a subset of these positive-testing samples, revealed that 55% had mixed UCBSV + CBSV infections, whereas 45% were only infected by UCBSV. There were no single CBSV infections. Sequences obtained from eight PCR products were edited and assembled using CLC Main Workbench version 7 (CLC bio, Qiagen) and deposited in GenBank (MF511061 to MF511068). A phylogenetic tree was generated using the maximum likelihood procedure in Mega 7.0 with default settings and 1,000 bootstraps. The tree topology showed that two new sequences from Ituri (557 and 562C) clustered with CBSV isolates from previously published data. These shared 97% identity with a published CBSV isolate from Uganda (KJ606250). UCBSV isolates identified in this study showed a high level of homology (99%) to isolate Ug_23 (FN434109) from Uganda (Namulonge). To our knowledge, this is the first report confirming the occurrence of both UCBSV and CBSV in the north-eastern part of DRC. It confirms the continued westward spread of the CBSIs that threaten cassava production in central and West Africa.