First Report of Meloidogyne enterolobii on Camellia oleifera in China

Camellia oleifera (family Theaceae) contains large amounts of oil and is therefore a valuable cultivated plant. This species is native to China, and it is one of the four largest woody species that produces oil in the world. C. oleifera seedlings in a nursery in Chengmai County (19°11′N, 111°1′E), Haikou City, Hainan Province, China, were observed to grow slowly, shed leaves, and exhibit signs of chlorosis in March 2017. The roots of diseased plants had galls, which are a typical symptom of infection by root-knot nematodes (Meloidogyne spp.). Roots from symptomatic plants were dissected, and females and egg masses were found. Egg masses were incubated in water at 25°C to obtain second-stage juveniles (J2). Morphological observations of J2 were performed using a microscope. The J2 had a slight constriction of the head area, a slender stylet, a large and round basal bulb, transparent tail area, and an obtuse tail tip. The female perineum was observed to be a nearly circular hexagon to an ellipse that had a wavy shape and tight lines. The back arch was high, and the lateral lines were not obvious. The morphological measurements (mean and range) of females (n = 20) were length (L) = 693.4 (536.1 to 713.9) μm, body width (BW) = 657.2 (531.3 to 743.6) μm, dorsal esophageal gland orifice to the stylet base (DGO) = 5.6 (4.5 to 7.1) μm, stylet length = 4.5 (13.2 to 18.1) μm, vulval slit to the anus = 26.4 (17.5 to 21.3) μm, and vulval slit length = 15.2 ± 1.5 (12.1 to 18.6) μm. The J2 (n = 20) measurements (mean and range) were: L = 467.1 ± 23.6 (419.6 to 491.2) μm, BW = 14.5 ± 2.35 (13.6 to 17.8) μm, stylet length = 13.7 ± 0.8 (10.2 to 14.1) μm, DGO = 4.7 ± 0.61 (3.5 to 5.6) μm, tail length = 51.5 ± 2.8 (43.1 to 58.9) μm, and hyaline tail terminus = 12.5 ± 1.89 (11.6 to 16.2) μm. Both the morphological features of J2 and females and the perineal pattern of the females match the original description of Meloidogyne enterolobii (guava root-knot nematode) (Yang and Eisenback 1983). Molecular analyses were also conducted to confirm the identification. Primers C2F3/1108 (GGTCAATGTTCAGAAATTTGTGG/TACCTTTGACCAATCACGCT) (Powers and Harris 1993) were used for mitochondrial (mt) DNA amplification and rDNA intergenic spacers 2. In addition, the primer D2A/D3B (GTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (Nadler et al. 1999) was used to sequence the 28s ribosomal RNA gene. The D2-D3 fragment was utilized for additional studies to identify the species. The target genes were 672 bp (GenBank no. MK990092) and 726 bp (MN007194), respectively. The sequence homology of the genes was more than 99% identical to that of the M. enterolobii in GenBank (MK45870 and KY033208). Species-specific primer Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006) was used to confirm the nematodes as M. enterolobii. A 200-bp amplification product was obtained, which was reported earlier for M. enterolobii. To confirm the pathogenicity, greenhouse experiments on C. oleifera were conducted. Seedlings were transplanted into 16 pots filled with autoclaved sandy soil (sand/soil = 1:1). After 8 weeks, 12 plants were used for inoculation with 1,000 J2 per pot (collected from the initial field and maintained as a pure culture), and four plants without inoculation were used as a control. Root galls were visible 65 days after inoculation. Sixteen weeks later, all the aerial parts of the inoculated plants showed symptoms similar to those observed in the C. oleifera nursery. The control plants displayed no symptoms. The final population of J2 in the inoculated pots was quantified, and the nematode reproduction factor (final population/initial population) was 16.7. These results confirm the pathogenicity of M. enterolobii on C. oleifera. M. enterolobii has become a highly important root-knot nematode in tropical and subtropical areas with a very wide host range. To the best of our knowledge, this is the first time that M. enterolobii has been identified as a parasite of C. oleifera in China.