Differential Seasonal Prevalence of Yellowing Viruses Infecting Melon Crops in Southern California and Arizona Determined by Multiplex RT-PCR and RT-qPCR

Whitefly-transmitted viruses have affected cucurbit production areas in the United States since the late 1970s, with the Sonoran Desert melon production region of Arizona and southern California particularly impacted. This region has historically had large populations of whiteflies (Bemisia tabaci), which has led to an associated prevalence of whitefly-transmitted viruses. Beginning in the 1980s, melons and other cucurbit crops in the region experienced severe losses due to squash leaf curl virus (SLCV; Begomovirus, Geminiviridae), and, especially, the crinivirus lettuce infectious yellows virus (LIYV; Crinivirus: Closteroviridae), which produced severe interveinal yellowing symptoms and resulted in unmarketable fruit. Both viruses were transmitted efficiently by B. tabaci biotype A, now known as B. tabaci NW, and were constraints for cucurbit production until B. tabaci NW was displaced by B. tabaci MEAM1 (biotype B) in the early 1990s (Wintermantel 2010). The emergence of MEAM1 led to extremely high populations of whiteflies, but lower rates of LIYV and SLCV transmission due to their greatly reduced transmissibility by MEAM1 compared with NW whiteflies (Wintermantel 2010). In the late 1990s a new whitefly-transmitted virus, cucurbit leaf crumple virus (CuLCrV; Begomovirus, Geminiviridae), emerged in the region (Brown et al. 2000; Guzman et al. 2000; Hagen et al. 2008), but losses associated with CuLCrV have remained minimal in the southwestern United States. The emergence of cucurbit yellow stunting disorder virus (CYSDV; Crinivirus: Closteroviridae) in 2006 was dramatic (Brown et al. 2007; Kuo et al. 2007), resulting in leaf mottle, severe interveinal yellowing symptoms, leaf brittleness, and low fruit sugars, eliminating production of most fall cucurbits and causing frequent infection of late spring cucurbit crops (Maliogka et al. 2020; Wintermantel et al. 2009, 2017). CYSDV now consistently infects nearly all fall-planted cucurbits in the low desert production regions of California and Arizona (Wintermantel et al. 2009), and fall production in the region has remained minimal due to lack of resistance in commercial varieties and insufficient whitefly control (Maliogka et al. 2020; Wintermantel et al. 2017). Recently, another crinivirus, cucurbit chlorotic yellows virus (CCYV) (Crinivirus: Closteroviridae) has emerged in the melon production regions of the United States (Hernandez et al. 2021; Kavalappara et al. 2021b; Mondal et al. 2021b, 2022; Wintermantel et al. 2019). This virus has been problematic in Mediterranean and Asian production regions and produces symptoms identical to those of CYSDV (Gu et al. 2011; Orfanidou et al. 2017). Although CCYV was not identified in California until 2018, it was later determined to have been introduced to the southwestern desert production region in 2014 (Wintermantel et al. 2019), about the same time as squash vein yellowing virus (SqVYV; Ipomovirus, Potyviridae; Batuman et al. 2015). The latter virus is best known for causing watermelon vine decline, a late season disease resulting in collapse of watermelon vines and fruit necrosis: (Adkins et al. 2008, 2011, 2013). SqVYV causes vein yellowing symptoms on squash (Cucurbita pepo) plants and mild yellowing on melon leaves, but does not result in economic loss in crops other than watermelon. In addition to the whitefly-transmitted viruses, the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; Polerovirus: Solemoviridae) first identified in California in 1993 (Lemaire et al. 1993) also periodically infects melon and other cucurbit plants in the Sonoran Desert region, but the virus is far more prevalent in California’s Central Valley where CYSDV and CCYV were recently identified (Mondal et al. 2021b). CABYV is not considered an economic concern in either the Central Valley or Southwestern Desert production regions, but the virus produces yellow mottle and interveinal yellowing symptoms (Ahsan et al. 2020; Lecoq et al. 1992) identical to those of the economically damaging criniviruses, CYSDV and CCYV, and the three viruses now frequently coinfect plants in all western production regions (Mondal et al. 2021b; this manuscript).

CYSDV, CCYV, and CABYV are referred to as “yellowing viruses” because they cause severe yellowing on leaves of cucurbit plants. In addition to the southwestern United States, CYSDV, CCYV, and CABYV are present throughout many of the cucurbit-growing regions of the world. CYSDV was first characterized in the 1990s (Célix et al. 1996) and is now present in the United States and Mexico in North America (Brown et al. 2007; Kao et al. 2000; Kuo et al. 2007; Polston et al. 2008), the Mediterranean region including but not limited to North Africa (Desbiez et al. 2000; Yakoubi et al. 2007), Lebanon (Abou-Jawdah et al. 2000), France (Desbiez et al. 2003), and Spain (Célix et al. 1996), as well as China in East Asia (Liu et al. 2010). CCYV, although having emerged more recently than CYSDV, is now widely distributed in the Middle East, North Africa, and East Asia, and recently in North America (Abrahamian et al. 2012; Amer 2015; Hernandez et al. 2021; Huang et al. 2010; Kavalappara et al. 2021b; Keshavarz et al. 2014; Mondal et al. 2021b, 2022; Orfanidou et al. 2017; Wintermantel et al. 2019; Zeng et al. 2011). CABYV was first isolated in Southern France. Since then this virus has been reported worldwide, including in Lebanon (Abou-Jawdah et al. 1997), Spain (Juarez et al. 2004), Italy (Tomassoli and Meneghini 2006), Iran (Bananej et al. 2006), Morocco (Aarabe et al. 2018), Indonesia (Listihani et al. 2020), Germany (Menzel et al. 2020), Slovenia (Mehle et al. 2020), and Pakistan (Ahsan et al. 2020). SqVYV was first reported in 2003 in the U.S. state of Florida (Webb et al. 2003) and has since spread to many southern U.S. states (Adkins et al. 2008, 2011), California (Batuman et al. 2015), Puerto Rico (Acevedo et al. 2013), and internationally to Guatemala (Jeyaprakash et al. 2015) and Israel (Reingold et al. 2016). Although it is not technically a yellowing virus, SqVYV is common in mixed infections due to its transmission by B. tabaci MEAM1, the vector of CYSDV and CCYV.

The steady introduction of new whitefly-transmitted viruses in cucurbit-growing areas illustrates a serious economic concern for production, as well as for breeding efforts to develop resistant varieties to control these viruses. When a single plant is infected with multiple viruses or multiple plants within the same field are singly infected with multiple viruses producing similar symptoms, it can be difficult to determine which virus is primarily responsible for symptoms and whether a plant may exhibit resistance to a particular virus unless the viruses can be differentiated from one another. With the increasing prevalence of mixed infections involving multiple viruses that produce similar symptoms (e.g., CYSDV, CCYV, and CABYV) or that are transmitted by the same vector (e.g., SqVYV or the related ipomovirus cucumber vein yellowing virus) in cucurbit production areas around the world, a critical need has developed for resources to distinguish these viruses from one another in mixed infections and to determine differential accumulation of each virus in such mixed infections. Introduction of CYSDV and CCYV into the California Central Valley melon production region has raised concern over the increased potential for economic damage from the yellowing viruses as has occurred in Sonoran Desert production regions, and this has increased the demand for a rapid and robust detection and quantification method to identify and quantify early infections and infections in breeding materials.

Several nucleic acid based polymerase chain reaction (PCR) assays have been developed to differentiate CYSDV from CCYV (Adkins et al. 2008; Orfanidou et al. 2019; Wang et al. 2014), but mixed infections now frequently involve more than just these two viruses. Similarly, a method was recently shown to differentiate CYSDV, CCYV, CuLCrV, and SqVYV (Jailani et al. 2021), but this method does not detect CABYV, which is common throughout all cucurbit-producing regions of the world, often with CYSDV and CCYV and, as noted, produces identical symptoms. Furthermore, no single reaction systems have been developed to not only differentiate, but to quantify, virus titers in mixed infections. The prevalence of CYSDV, CCYV, SqVYV, and CABYV in many regions of the United States and other parts of the world and the symptom similarity among three of the four viruses necessitate the development of a method for their efficient detection and differentiation. Therefore, we have developed and validated a single-step multiplex RT-PCR method that rapidly identifies and differentiates all four viruses (CYSDV, CCYV, SqVYV, and CABYV). Furthermore, we have developed a multiplex single step RT-qPCR that determines the titer of each of these viruses from either single infections or mixed infection of up to four viruses in a single plant. These methods have been validated and applied during a survey for these viruses in the Sonoran Desert production regions of California and Arizona, U.S.A., which illustrated the abundance of mixed infections of melon and very clear seasonal differences in virus prevalence.

Materials and Methods

Virus sources and RNA extraction

Melon leaves used in the experiments were those collected from melon plants showing yellowing symptoms typical of those caused by CYSDV, CCYV, or CABYV collected from Imperial and Riverside Counties, CA, and Yuma County, AZ, U.S.A., as well as melon or zucchini squash tissue from pure culture stocks of these viruses or of SqVYV from isolates maintained at the USDA-ARS facility in Salinas, CA. Plant tissue serving as a negative control was collected from healthy melon or zucchini plants grown in greenhouses or growth chambers.

For analysis of small numbers of plant samples (approximately 20 samples or fewer) total RNA was extracted from melon leaves using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA), according to the manufacturer’s protocol and including the optional DNase treatment step. The extracted RNA was eluted with 50 μl RNase-free water, quantified and checked for purity using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA). The RNA was also visualized on a 1% agarose gel (nondenaturing) to ensure integrity of the RNA and absence of genomic DNA.

For larger numbers of plant samples, two additional methods were used. One method involved total nucleic acid extraction from plant samples using the method described by Dellaporta et al. (1983) with modifications as described in Mondal and Gray (2017) and Mondal et al. (2016, 2017a, b) and included subsequent treatment with DNase. For high-throughput automated extraction, total RNA was isolated using the KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific) with the MagMax Plant RNA Isolation kit (Thermo Fisher Scientific) following manufacturer recommendations. Briefly, 0.1 g of leaf tissue was freeze dried at −40°C in a plant tissue lyophilizer, followed by grinding the dried tissue with a bead shaker before proceeding with the automated RNA extraction. The DNase treatment step was included to optimize RNA recovery. RNA purified by this method was used for both individual and single step multiplex RT-PCR and single step multiplex RT-qPCR (detailed below). RNA samples were quantified and evaluated for purity using the NanoDrop 2000 spectrophotometer and selected RNA extracts were examined on a 1% agarose gel to confirm integrity.

Designing the multiplex primer set for RT-PCR.

Primers for RT-PCR were designed using the PrimerQuest tool available online from Integrated DNA Technologies (IDT, Newark, NJ). Comparable melting temperatures (Tm = 62°C) of the primers were selected and the target optimal annealing temperature was set at 57°C for each primer pair to facilitate multiplexing, but with varying amplicon lengths designed for clear and easily distinguishable bands on a 1% agarose gel (Table 1). Primers were designed to specifically amplify sequences of the RNA dependent RNA polymerase (RdRp) genes of CYSDV (NC_004809), CCYV (NC_018173), CABYV (NC_003688), and the NIa gene of SqVYV (NC_010521; Table 1). The specificity of each primer pair for its target virus was determined by RT-PCR followed by DNA sequencing of amplicons, and the fidelity of each primer pair was confirmed.

Table 1. Primer sets for virus-specific RT-PCR amplification of each of four viruses from single or mixed infections

Primer set	Sequence	Start	Length	Melting temperature (°C)	% GC	Amplicon (bp)	NCBI accession
CCYV_RdRp forwarda	CTCCGAGTAGATCATCCCAAATC	13	23	62	48	953	NC_018173
CCYV_RdRp reversea	TCACCAGAAACTCCACAATCTC	965	22	62	45
CYSDV_RdRp forwardb	TTTCGGCTCCCAGAGTTAATG	347	21	62	48	492	NC_004809
CYSDV_RdRp reverseb	CGATCTCCGTGGTGTGATAAG	838	21	62	52
CABYV_RdRp forwardc	AAGAGCGGCAGCTACAATAC	171	20	62	50	277	NC_003688
CABYV_RdRp reversec	TGCCACATTCCGGTTCATAG	447	20	62	50
SqVYV_Nib_RdRp forward	TCTCTATCGCCCGTCCTATT	757	20	62	50	723	NC_010521
SqVYV_Nib_RdRp reverse	AGGCATGAGTGCTTCCATATC	1,479	21	62	48

^a CCYV primers were used independently in Kavalappara et al. (2021b).

^b CYSDV primers were used independently in Kavalappara et al. (2021a).

^c CABYV primers were used independently in Mondal et al. (2021b).

View as image HTML

Designing the multiplex primer set for RT-qPCR.

The primers and probes for RT-qPCR were designed using the RealTimeDesign qPCR Assay Design Software available online from LGC-Biosearch Technologies (biosearchtech.com). As with traditional RT-PCR, forward and reverse primers for RT-qPCR were also designed to the RdRp region of RNA1 of CYSDV, CCYV, and CABYV and to the NIa region of SqVYV (same accessions listed above and in Table 1). A reference gene for the assay was designed to the Cucumis melo ADP ribosylation factor gene (Unigene ID#MU47713), determined to be the most stable reference gene for C. melo (Kong et al. 2014). Table 2 lists the primer/probe sequences and fluorophores/quenchers used for each target.

Table 2. Primer sets for virus-specific quantitative RT-qPCR amplification of each of four viruses from single or mixed infections

Virus	Forward primer	Reverse primer	Probe
CCYV	ACGGTGGGAGAGTTAGAGTGA	CTCTTCGTCTGATTGGTGTGGATA	FAM-CACCAGACGCGCAGAGGATGTTC-BHQ1
CYSDVa	TGATGACGGGAAGGTTAGAGT	CTTCGGATCGGGTTGGACA	HEX-TGCCAGATGCACAGAGGATGTTCG-BHQ1
SqVYV	GGGATCGCCTTGCTAACACAT	AGGACGGGCGATAGAGAAC	Quasar 670-TGATCACACGTGGAAATTTATCGACTGT-BHQ2
CABYV	CCGCCTGTTTCTCAATTCTCAATG	CAGCCACTGGTGGAGAGTTTC	Quasar 705-TTGCGGTCTGATCCTTCCCTTGTC-BHQ2
MELON-ADP	GTGGTGGATAGCAATGACAGAGA	CCTCAGCTCGTCCTCATTCAAC	CAL Fluor Red 610-TCGAAGCTAGGGATGAGCTGCAC-BHQ2

^a CYSDV forward and reverse primers and probe were used independently in Tamang et al. (2021).

View as image HTML

Development of two-step multiplex RT-PCR and validation.

Initially, the multiplex RT-PCR detection system was designed as a two-step multiplex RT-PCR to differentiate and confirm infection by any or all of the four viruses, CYSDV, CCYV, SqVYV, and CABYV, in a single RT-PCR reaction. For reverse transcription using M-MLV reverse transcriptase (Promega, Madison, WI), 3 μl of total RNA was combined with 1 μl of random hexamer primers (0.5 μg/μl) and 9.5 μl of RNase-free water, and was incubated at 70°C for 5 min, then immediately placed on ice. The master mix was prepared according to the manufacturer’s instructions for a 20 μl volume reaction and included 0.5 μl of RNase Inhibitor (Promega). The reaction mix was incubated in a thermocycler at 25°C for 5 min followed by 30 min at 37°C, 20 min at 42°C, and a final hold at 4°C. The cDNA product was subsequently either placed on ice for immediate use or frozen at −20°C for later use.

The multiplex PCR was performed using a Multiplex PCR kit (Qiagen, Venlo, the Netherlands). All forward and reverse primers in Table 1 were diluted to a 10 mM working solution and then combined in equal proportions to produce a forward and a reverse primer mixture of 200 nm each. A 25 μl reaction contained 12.5 μl of 2X Reaction Mix, 2 μl of each of the forward and reverse primer mixtures, 2 μl of cDNA template, and 6.5 μl of water. The cycling parameters were as follows: 95°C/5 min; 35 cycles of 94°C/30 s, 57°C/90 s, and 72°C/90 s; ending with a final extension of 72°C/10 min, followed by a final holding temperature at 4°C. This multiplex PCR system was further validated using the Applied Biosystems Platinum Multiplex PCR Master Mix (Thermo Fisher Scientific), with similar results obtained by using the above primer concentrations and following the manufacturer’s thermal cycling protocol. The PCR products were examined by gel electrophoresis (details below) to confirm the expected amplicon size (Table 1).

Single step multiplex RT-PCR

A single-step multiplex RT-PCR method (Mondal et al. 2016, 2017a, b; Mondal and Gray 2017) was developed using the multiplex primer system described above to streamline the reaction and reduce the cDNA synthesis steps. The reaction master mix was prepared using the Bio-Rad iTaq Universal Probes One-Step Kit (Bio-Rad, Hercules, CA), RediLoad loading buffer (Thermo Fisher Scientific) and sample RNA, instead of cDNA. Each 20 μl reaction mix contained 10 μl of PCR reaction mix (0.5 mM of each dNTP, Mg⁺⁺, antibody-mediated hot start Taq DNA polymerase, stabilizers), 4.5 μl of nuclease-free (DNase/RNase) water, 1 μl each of both the forward and reverse primer mix (see above, Table 1), 2 μl of RediLoad loading buffer, 0.5 μl of iScript RT (50× formulation of iScript RNase H+ M-MLV reverse transcriptase), and 1 μl of sample RNA extract. Thermal cycling consisted of 15 min at 50°C for cDNA synthesis; 5 min at 94°C for reverse transcriptase inactivation; 35 cycles of 30 s at 94°C, 90 s at 57°C, and 90 s at 72°C; a final extension at 72°C for 10 min; and storage of the PCR product at 4°C. After the PCR reaction, 15 μl of the final amplified PCR product was analyzed by gel electrophoresis on a 2% agarose gel, staining the product with SYBR Safe DNA gel stain (0.1 µl/ml) and observing the gel under UV light (302 nm).

Further validation of these methods included secondary confirmation of viruses present in samples using a single-step multiplex RT-PCR targeting the capsid protein (CP) genes of these viruses. Each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nucleotide (nt) sections of the CP gene of each virus, respectively, encoded on RNA2 (Wintermantel et al. 2009, 2019). SqVYV and CABYV infections were confirmed with primers designed to the CP gene that amplified a 591-nt and 598-nt section of each virus, respectively (Adkins et al. 2008; Kassem et al. 2007). The amplicons were bidirectionally sequenced at MCLab (South San Francisco, CA) and were confirmed as expected.

Development of two-step RT-qPCR.

A multiplex RT-qPCR method was developed to quantify all four viruses during mixed virus infections. Total RNA for RT-qPCR was either extracted using the Qiagen RNeasy kit or the MagMax Plant RNA Isolation kit as described above. The cDNA was synthesized using iScript RT Supermix for RT-qPCR (Bio-Rad). A 10-μl reverse transcription reaction included 2 μl of 10× Supermix solution and 100 ng of sample RNA, with volume adjusted using nuclease-free water. The solution was incubated at 25°C for 5 min, at 46°C for 20 min, and 95°C for 1 min. The cDNA was either placed on ice for immediate use in qPCR or frozen at −20°C for later use.

Quantitative PCR (qPCR) was performed using PerfeCTa Multiplex qPCR Toughmix (QuantaBio, Beverly, MA) with a CFX96 thermocycler (Bio-Rad). A 25 μl qPCR reaction included 5 μl of reaction master mix, 0.6 μl of each forward and reverse primer and probe (300 ng each) targeting each of the four viruses and the reference gene, melon ADP, 10 μl of water, and 1μl of cDNA template. Cycling parameters consisted of 95°C for 3 min, followed by 40 cycles at 95°C for 10 s and 60°C for 60 s. Amplicons generated by the RT-qPCR primers for each of the targeted viruses were cloned separately into pGEM-T easy vectors (Promega). The plasmids were confirmed by sequencing (MCLab), linearized and quantified, and used to generate a standard curve to allow for absolute quantification of virus titer. A standard 10-fold dilution series (four to six data points) was prepared and included in each plate. Virus titer data were quantified only after PCR efficiencies were confirmed to be between 90 to 110% with an R² value that was above 0.99. The absence of amplification of a no template control, a control with no reverse transcriptase added to the reaction mix (no RT control), and healthy melon RNA were all confirmed as part of the system validation.

Development of one-step RT-qPCR.

The RT-qPCR was further modified to a more efficient one-step procedure in which prior cDNA synthesis is not needed. Total RNA for RT-qPCR was either extracted using the Qiagen RNeasy kit or the MagMax Plant RNA Isolation kit as described above. A 20 μl RT-qPCR reaction mastermix included 10 μl of Bio-Rad iTaq Universal Probes one-step reaction mix, 0.5 μl of iScript RT (50× formulation of iScript RNase H+ M-MLV reverse transcriptase), 0.5 μl of each forward and reverse primer and fluorogenic probe (300 ng each) targeting each of the four viruses and the melon ADP reference gene, 1 μl of water, and 10 to 100 ng of sample RNA, with volume adjusted to 1 μl using nuclease-free water. Cycling parameters consisted of 50°C for 10 min (for reverse transcription), 95°C for 3 min, followed by 40 cycles at 95°C for 15 s and 60°C for 30 s. A standard 10-fold dilution series (eight data points) was prepared and included in each plate. Control treatments included a no template control (blank), a control with no reverse transcriptase added to the reaction mix (No RT control), and healthy melon RNA (negative control). Virus titer data were quantified with 90 to 110% efficiency with an R² value of above 0.99.

Application of single step RT-PCR and RT-qPCR

The single step RT-PCR described above was used to detect the presence of viruses in field samples collected during the spring and fall melon seasons of 2019, 2020, and 2021 in Imperial and Palo Verde Valleys, CA, and near Yuma, AZ. Briefly, several melon leaf samples were collected from plants from commercial and research fields in these regions and were transported to the laboratory packed in ice. Fresh leaf tissue (0.1 g) was collected from an individual leaf of each plant sampled, placed in microcentrifuge tubes, and subsequently lyophilized. Total RNA was extracted using the MagMax plant RNA isolation kit (detailed above). Single-step RT-PCR was performed using the Bio-Rad iTaq Universal Probes one-step kit (detailed above) to detect the presence of each virus. Twenty-four field-collected samples were used to determine virus titer for validation of RT-qPCR.

Additionally, in the fall of 2019, eight cantaloupe melon plants (var. Top Mark) grown under field conditions and exhibiting typical yellowing symptoms characteristic of infection by CYSDV, CCYV, or CABYV were sampled under natural infection from a research test plot at the Desert Research and Extension Center, Holtville, CA. Total RNA from those samples was extracted using the MagMax plant RNA isolation kit as described above, followed by testing with the single step RT-PCR for the presence of viruses. All samples tested were found to be infected with both CYSDV and CCYV. RT-qPCR was used to determine and compare differential virus accumulation in sequential leaves along an individual melon vine from each of the eight plants. No plants were found with single infections of either CYSDV or CCYV from this field, therefore that comparison was not possible.

Results

Simultaneous detection of virus complexes using multiplex RT-PCR

Both two-step and single-step RT-PCR reactions using multiplexed primer sets that were developed in this study, with forward and reverse primers specific for each virus, produced clean amplicons of the expected sizes (Fig. 1; Table 1). Single infection and all possible RNA combinations of all viruses (CABYV, CYSDV, SqVYV, and CCYV), produced 277, 492, 723, and 953 bp size amplicons, respectively, when present individually (Fig. 1, lanes 1 to 4) and in mixed infections of different proportions (Fig. 1, lanes 5 to 15). No false amplification was observed with or without the presence of virus RNA in the reaction mix, and regardless of the number of viruses present in mixed infections. The negative controls (healthy melon, blank solution, and no RT control) did not produce any amplicons (Fig. 1, lanes 16 to 18).

Download as PowerPoint

Simultaneous quantification of CYSDV, CCYV, SqVYV, and CABYV using RT-qPCR

The two-step RT-qPCR assay simultaneously quantified CYSDV, CCYV, SqVYV, and CABYV, along with melon ADP (reference gene; Fig. 2A). A standard 10-fold dilution series was included with at least four data points on the same PCR plate for all five targets, and each showed PCR efficiencies (E) of 100.5 to 106.6% (Fig. 2B). All R² values were from 0.993 to 1.000 (Fig. 2B). As an additional validation, a four-point dilution series of the RNA extracts, prior to reverse transcription, was prepared and a standard curve of 10-fold dilutions showed PCR efficiencies and R² values similar to those in the DNA dilution series (data not shown). No amplification was detected in the no-template controls (NTC), no-RT controls (NRT), and healthy tissue negative controls, and no cross amplification was observed for any of the nontarget viruses (Fig. 2A).

Download as PowerPoint

Virus detection in 2019 field samples

A limited number of field samples (n = 10) were collected in the spring of 2019 from a research field at the Desert Research and Extension Center (DREC) in Imperial County, CA, and evaluated for virus content using the multiplex RT-PCR method. All 10 samples were found to be infected with CCYV; however, CYSDV was found in mixed infections with CCYV in two of the plants sampled (Fig. 3; Table 3). Amplicons of each of the samples were bidirectionally sequenced, which confirmed that these amplicons were of the anticipated target sequence for each virus (data not shown).

Download as PowerPoint

Table 3. Virus incidence among commercial melon fields in low desert production regions of California and Arizona sampled in 2019, 2020, and 2021, as determined by multiplex RT-PCR

Virus or combinations present	2019		2020		2021
	Spring (infection total = 10/10)	Fall (infection total = 34/47)	Spring (infection total = 21/58)	Fall (infection total = 49/49)	Spring (infection total = 88/95)	Fall (infection total = 96/100)
CYSDV only	0	11	1	27	7	47
CCYV only	8	0	9	5	67	1
SqVYV only	0	0	0	0	0	0
CABYV only	0	3	3	0	5	0
CYSDV + CCYV	2	11	6	6	6	13
CYSDV + SqVYV	0	6	0	6	0	9
CYSDV + CABYV	0	1	0	4	0	0
CCYV + CABYV	0	0	2	0	1	0
CYSDV + CCYV + SqVYV	0	2	0	0	1	26
CYSDV + SqVYV + CABYV	0	0	0	1	0	0
CCYV + CYSDV + CABYV	0	0	0	0	1	0

View as image HTML

During the 2019 fall melon season, leaves were collected from 47 melon plants from nine fields in Imperial and Riverside Counties, CA, and in Yuma County, AZ, based on the presence of yellowing symptoms. Of the 47 samples tested, 34 were found to be infected with at least one virus. The results demonstrated an abundance of CYSDV among the fall melon samples from throughout the region with 31/34 infected plants (91%) and 66% (31/47) of the total number of plants evaluated testing positive for CYSDV (Table 3; Fig. 3, lane 14). CCYV was also detected in 38% (13/34) of infected plants, and in 42% (13/31) of the CYSDV-infected plants (Table 3; Fig. 3, lane 2; Fig. 4). No single infections of CCYV were identified during the fall season (Table 3). SqVYV was detected in 24% of infected plants (8/34) and 17% of total plants tested (8/47), and in 26% of the CYSDV-infected plants (8/31). Like CCYV, all SqVYV-infected plants during the fall season were either coinfected with CYSDV (Fig. 3, lane 4, compared with the SqVYV control in lane 3), or with both CYSDV and CCYV (Table 3; Fig. 3, lane 6). These results illustrate the dominance of CYSDV infections in the 2019 fall crop (Fig. 4). Interestingly, all SqVYV-infected plants were from Arizona; no SqVYV was detected in any of the samples collected from Imperial or Riverside counties in California during the fall of 2019. In addition, CABYV was identified in only four melon plants (Table 3), all from a single field in Arizona. Three of these melon plants were infected with CABYV alone (Fig. 3, lane 7), whereas one was coinfected with CYSDV (Table 3; Fig. 3, lane 8).

Download as PowerPoint

Virus detection in 2020 field samples

In the spring of 2020, several melon, squash, and weed samples (n = 58) were collected from low desert melon growing areas of southwestern Arizona and southern California. RNA extracts from leaf samples were evaluated for virus content using the multiplex RT-PCR. Although sampling was limited during initial surveys in spring 2019, CCYV was the predominant virus in spring melon and squash plants (Fig. 4). In spring 2020, a more extensive sampling also revealed the dominance of CCYV infections in the majority of plants (Fig. 4). Among 21 positive melon and squash plants, nine plants were determined to be infected by CCYV alone (Table 3; Fig. 3, lane 5), one plant with single infection of CYSDV, three plants with CABYV, and eight plants with mixed virus infections (Table 3). Among the mixed infections, six plants were infected with CYSDV and CCYV and two other plants were infected with CCYV and CABYV. No virus was detected in the watermelon samples from Arizona during spring 2020.

In the fall of 2020, 49 samples (n = 49) were collected from 11 different commercial melon and watermelon fields in southern California and Arizona. The plant samples were collected based on the presence of yellowing symptoms on leaves resembling those caused by yellowing viruses, and it should be noted that most plants in the region developed yellowing symptoms during the fall season. Similar to the results of sampling during the fall of 2019, CYSDV was the most abundant of the four viruses during the fall of 2020; 90% (44/49) of the plants were infected with CYSDV, either singly or in mixed infections with other viruses (Fig. 4; Table 3). CCYV was detected in 22% of total plants sampled (11/49), and in 14% of CYSDV-infected plants (6/44) (Fig. 4; Table 3). However, in contrast to the fall sampling of the previous year, five plants were found to be infected with only CCYV during the fall of 2020, comprising 10% of total plants sampled (Table 3). SqVYV was detected in 14% of the total infected plants (7/49), and in 14% (6/44) of the CYSDV-infected plants (Table 3). As in the fall of 2019, all SqVYV-infected plants from fall 2020 were coinfected with another virus; either with CYSDV (six plants), or with CYSDV and CABYV (one plant; Table 3). All SqVYV-infected plants in fall 2020 were from Arizona. CABYV was identified in three melon and two watermelon plants (Table 3), and was found in mixed infections with CYSDV, and in one plant with CYSDV and SqVYV (Table 3).

Virus detection in 2021 field samples

In the spring of 2021, 88/95 melon samples were found to be infected with at least one virus. As in the previous 2 years, CCYV was the most abundant virus (Fig. 4; Table 3). Among the 88 virus-infected samples, 76 samples were found to be infected with CCYV, either singly (67 plants) or in combination with other viruses (nine plants); comprising 86% of the total spring infections (Fig. 4; Table 3). CYSDV was found only in 15 infected samples (16% total infected plants), seven with CYSDV alone and eight in mixed infections with other viruses (Fig. 4; Table 3). CABYV was detected in 7/88 infected plants; five infected with CABYV alone, one infected with CCYV, and one infected with both CCYV and CYSDV (Table 3). SqVYV was found in only one plant that was also infected with CYSDV and CCYV (Table 3).

CYSDV was again the most prevalent virus during the 2021 fall season, infecting 96/100 plant samples either singly or in combination with other viruses (Fig. 4). CYSDV was found either singly (47 plants) or in combinations (48 plants); comprising 99% (95/96) of the infection total (Fig. 4; Table 3). CCYV was more abundant in fall 2021 compared with the previous fall season, with 40 plants infected with CCYV (42% of total infections) either alone (one plant) or in combination with other viruses (39 plants; Fig. 4; Table 3). SqVYV was found in 35 plants (36% total infections), but always in mixed infections with either CYSDV or with both CYSDV and CCYV (Table 3). No samples were found to be infected with CABYV during the fall of 2021 (Table 3).

Virus incidence in weed/noncucurbit hosts.

A limited number of weed plants were collected from within and near melon fields during the 2021 spring and fall seasons. Among 52 weed samples collected, 24 plants were infected with at least one of the four viruses (46%; Table 4). Alkali mallow (Malvella leprosa, also known as Sida hederacea), ground cherry (Physalis sp.), and common sowthistle (Sonchus oleraceus) were found to be infected with CCYV, CABYV, or both viruses (Table 4). CYSDV was also detected in prickly lettuce (Lactuca serriola), lambsquarters (Chenopodium album), and purslane (Portulaca oleracea) plants (Table 4).

Table 4. Virus incidence in weed plants within and adjacent to commercial melon fields in low desert production regions of California sampled in 2021, as determined by multiplex RT-PCR

Name of the weed	Total plants sampled	Virus incidence
Pigweed (Amaranthus sp.)	2	–
Sow thistle (Sonchus oleraceus)	10	2 CABYV, 1 CCYV + CABYV
Prickly lettuce (Lactuca serriola)	6	1 CABYV, 2 CYSDV
Ground cherry (Physalis sp.)	10	6 CABYV, 1 CCYV, 2 CCYV + CABYV
Lambsquarters (Chenopodium album)	2	1 CYSDV + SqVYV
Goosefoot (Chenopodium sp.)	8	1 CABYV
Purslane (Portulaca oleracea)	2	1 CYSDV
Bindweed (Convolvulus arvensis)	2	2 CABYV
Alkali mallow (Malvella leprosa)	8	4 CCYV
Unknown	2	–

View as image HTML

Quantification of virus in mixed virus infected plants using RT-qPCR

Melon plants (var. Top Mark) susceptible to both CYSDV and CCYV were grown during the fall melon season of 2019 in a CYSDV resistance trial at the Desert Research and Extension Center near Holtville, CA, in the Imperial Valley. In September 2019, approximately 1 month after planting (direct seeding), leaves were sampled sequentially along an individual melon vine from eight randomly selected plants in border rows of the resistance trial in order to determine if leaf position influences virus titer in field experiments evaluating plants for resistance to CYSDV or CCYV. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) as described above. RT-qPCR was used to compare differences in virus titer among progressive leaves along melon vines from the first leaf on the vine near the crown (basal leaf) to the eighth leaf away from the crown (distal leaf), during coinfections of CYSDV with CCYV. The basal leaves (Position 1, Fig. 5A) were found to have higher relative titers of both viruses (lower Cq value), whereas the terminal leaves (position 8, Fig. 5A) had the lowest titers based on numerically higher Cq values. CYSDV was present at comparatively higher titer than CCYV at all leaf positions of the vines sampled (Fig. 5B) during this preliminary experiment. None of the Top Mark melon plants sampled from the trial were found to be infected with only CYSDV or CCYV; therefore, direct comparison with virus titer in single infections was not possible for this experiment.

Download as PowerPoint

Discussion

Since the late 1990s, a series of whitefly-transmitted viruses that produce yellowing disease in cucurbit crops have emerged throughout cucurbit-producing regions of the United States causing serious concern for growers. The first member of this yellowing virus complex to emerge in the United States was CYSDV in Texas (Kao et al. 2000), followed by its introduction to the Sonoran Desert production areas including the Imperial Valley of California and the adjacent Arizona melon production areas in 2006 (Brown et al. 2007; Kuo et al. 2007). As a result of the economic impact of CYSDV on the Sonoran Desert melon production areas and its establishment there in weed and crop hosts (Wintermantel et al. 2009), public and commercial breeding efforts began focusing on the development of melon varieties with resistance to CYSDV, with regular field trials conducted in this important production area. Breeding efforts progressed well, with the identification of sources of CYSDV resistance (McCreight and Wintermantel 2011); however, beginning around 2015 melon breeding materials with a history of resistance against CYSDV no longer performed as effectively at preventing the development of yellowing symptoms in research trials. Although this was initially perplexing, the reason soon became apparent. A related but distinct yellowing virus, CCYV, was identified in the Imperial Valley in 2018. Subsequent evaluation of RNA extracts from melon breeding trial samples that were expected to be CYSDV resistant but had not performed well against CYSDV were determined to be infected with CCYV (Wintermantel et al. 2019). Analysis of previously frozen nucleic acid extracts from resistance trials and other field samples demonstrated that CCYV had been present in the Imperial Valley since 2014, and its emergence there coincided with that of another whitefly-transmitted virus, SqVYV, which had been identified in 2014 (Batuman et al. 2015).

Development of the multiplex RT-PCR and RT-qPCR methods described herein resolve the challenge of determining which virus is causing symptoms and whether the virus can accumulate in a plant or variety by providing rapid detection and quantification of the three primary yellowing viruses affecting cucurbit crops globally (CYSDV, CCYV, and CABYV) and SqVYV, a common ipomovirus that frequently coinfects cucurbit crops because it is transmitted by the same whitefly vector that transmits CYSDV and CCVY. The multiplex single-step or two-step RT-PCR is able to detect any number of target viruses, from one to all four, as illustrated in Figure 1. This system was field validated over 3 years by evaluating the prevalence of each of the four viruses during both the spring and fall melon seasons of 2019, 2020, and 2021 in the Sonoran Desert production area of Arizona and California. The multiplex RT-PCR system clearly differentiated plants infected with different combinations of the target viruses, and the multiplex RT-qPCR demonstrated differential patterns of virus accumulation within plants. Spring sampling in both years found an abundance of CCYV, but limited infection of plants with CYSDV. This indicates that CCYV, the virus that was first detected in desert melon production in 2014, has become the predominant virus in the spring crop, displacing CYSDV, which had been the sole whitefly-transmitted yellowing virus in the region for nearly a decade. However, during the fall season, CYSDV remained the most prevalent virus. Interestingly, although CYSDV was often detected as single infections during the fall melon seasons, a majority of the CCYV infections occurred as coinfections with CYSDV (Table 3). The basis for the differences in virus abundance between the two melon growing seasons remains unclear and will require further epidemiological study but could be influenced by the abundance of critical virus reservoir hosts.

The noncucurbit crop host range of CYSDV in the region is well documented through both field and greenhouse studies (Wintermantel et al. 2009, 2016), and important regional reservoir hosts have been identified (Wintermantel et al. 2016). Although two previous studies have examined the host range of CCYV (Okuda et al. 2013; Orfanidou et al. 2017), critical reservoir hosts that harbor CCYV and serve as sources for introduction of CCYV to cucurbit crops have not been determined in the Sonoran Desert region of California and Arizona. Among several weed samples collected and tested, alkali mallow, sowthistle, and ground cherry were found infected with CCYV (see Table 4), both as single and mixed infections with CABYV. This finding demonstrates the importance of determining overwintering reservoir hosts of CCYV in the region because this newly introduced virus has clearly established itself as the predominant virus responsible for yellowing during the successive spring seasons. The seasonal abundance of weed or other noncucurbit reservoir hosts of CCYV may influence its prevalence during the spring and early summer. Whitefly populations increase gradually in the Sonoran Desert during the spring crop and remain high throughout the summer and fall (Chu et al. 2007; Gonzalez et al. 1992; McCreight et al. 1995), and some cucurbit fields can usually be found throughout the summer months. Therefore, the primary inoculum sources for fall cucurbit crops are likely cucurbit crops that were planted earlier in the summer and some weed hosts including those listed in Table 4. Further studies will be necessary to determine what drives the prevalence of CYSDV over CCYV during the fall season, and this could include mixed infection dynamics of CYSDV and CCYV in melon as has been examined for cucumber (Abrahamian et al. 2015; Mondal et al. 2021b), differences in transmission efficiency, differential accumulation in cucurbit or other hosts, or perhaps other factors yet to be identified.

Differential accumulation during mixed infections is common with many closely related plant viruses and can lead to either synergism or antagonism (Mondal et al. 2021a, c, 2023; Shrestha et al. 2014; Syller 2012). CYSDV and CCYV are both members of the genus Crinivirus and were found as mixed infections in many of the field-collected melon leaf samples tested. The multiplex quantitative RT-PCR method described herein can measure differences in accumulation of CCYV, CYSDV, SqVYV, and CABYV during mixed infections of one or more of these viruses, as shown in Figure 2. The RT-qPCR method was further validated in studies designed to determine the optimal location to sample melon leaves on a vine for comparison of virus titer among plants, by determining titer of each virus in susceptible melon plants from a breeding trial infected with both CYSDV and CCYV. When RT-qPCR was used to determine virus titer in different leaves of a melon vine, the basal leaf on the melon vines near the crown accumulated higher relative virus titers for both CYSDV and CCYV than did the distal leaves further toward the tip of the vine (Fig. 5). Furthermore, CYSDV accumulation was higher in most of the samples relative to CCYV. This suggests a possible competitive advantage for CYSDV over CCYV, however more studies are required as CYSDV was also the most abundant virus in fields during fall 2019 when the samples were collected.

Although SqVYV is a serious constraint for watermelon production in the southeastern United States (Adkins et al. 2013), the Middle East (Reingold et al. 2016), and Central America (Jeyaprakash et al. 2015) due to the ability of this virus to induce watermelon vine decline, to the best of our knowledge this virus has not resulted in watermelon vine decline in the Sonoran Desert region to date. The California isolate of SqVYV is capable of inducing vine decline in watermelon plants (O. Batuman and R. L. Gilbertson, personal communication), but causes only mild foliar yellowing symptoms on melon leaves as single infections and is not believed to impact melon yield in the region. However, the results of multiplex RT-PCR presented herein show that SqVYV remains present in this region where melon is the primary cucurbit crop, but in our survey was always found in mixed infection with CYSDV, CCYV, or both. Our studies also demonstrated that CABYV, an aphid-transmitted virus that causes symptoms identical to those of CYSDV or CCYV, can also be responsible for melon yellowing in the region and can coinfect plants with CYSDV or CCYV. CABYV is common in the Central Valley of California (Lemaire et al. 1993; Mondal et al. 2021b) but is much less common in the Sonoran Desert production area.

The multiplex RT-qPCR developed in this study can be applied in breeding programs to determine potential sources of resistance to CCYV and CYSDV among melon germplasm based on differences in virus accumulation. Tamang et al. (2019, 2021) used the primers and probes described here for the detection and subsequent quantification of CCYV and CYSDV along with the melon ADP control to evaluate the accumulation of each virus in Cucumis melo breeding materials. The trials were conducted during the fall season in the Imperial Valley, where both viruses have been prevalent and are now frequently found infecting the same plants since the introduction of CCYV to the region in 2014. Whitefly populations in the Imperial Valley are exceptionally high during the fall season (Chu et al. 2007; Gonzalez et al. 1992; McCreight et al. 1995), leading to higher virus infection by whitefly-transmitted viruses such as CYSDV. This has made this region a suitable location to evaluate and select cucurbit germplasm for resistance to CYSDV during the fall season (Wintermantel et al. 2017) and has resulted in advancement of several sources of CYSDV resistance (McCreight and Wintermantel 2011). However, the ability to evaluate plants for CYSDV resistance was confounded with the emergence of CCYV in the region because the symptoms of these viruses are indistinguishable from one another. This created a dilemma for breeding programs, but the new multiplex virus detection and quantification system has largely resolved this problem. Although foliar symptoms produced by the yellowing viruses are indistinguishable in field-grown plants, the RT-qPCR system allows high-throughput and sensitive quantification of multiple viruses in a single reaction allowing plant breeders to determine lines with or without virus accumulation, and to differentiate lines with lower and higher levels of accumulation even during mixed virus infections. For example, CYSDV probes were used independently to examine virus titers in breeding lines as part of a study on QTL mapping for resistance in one of the CYSDV-resistant breeding accessions. This was critical for completing the study as plants from field trials were frequently coinfected with CCYV (Tamang et al. 2021). Additionally, Tamang et al. (2019), using the CYSDV and CCYV probes from the multiplex system described herein, demonstrated that the melon lines MR-1 and Ananas Yoqne’am’ accumulated CCYV at only 1 and 2%, respectively, compared with titers in the susceptible variety, Top Mark. Interestingly, MR-1 had previously been shown to exhibit reduced symptom severity but had not shown reduced virus titer (Okuda et al. 2013). Timing of sampling and leaf selection may be a critical factor in developing a scoring system and this may explain the discrepancy between the two studies. In the present study we showed that the basal leaves near the crown of a melon vine accumulate both CYSDV and CCYV more than distal leaves near vine tips. Furthermore, previously unpublished work on CYSDV resistance demonstrated that sampling varieties for resistance is most effective when performed as yellowing symptoms are still spreading down the vines (Wintermantel, unpublished data). It is possible that a similar pattern may occur with CCYV infection of melon, and further analysis using the multiplex RT-qPCR system may demonstrate the most efficient time at which sampling should be performed for the evaluation of virus accumulation in resistance trials for control of both viruses.

Both multiplex RT-PCR and multiplex RT-qPCR offer opportunities for early detection of yellowing viruses, which can contribute toward limiting the spread of these pathogens among cucurbit production regions. One of the major issues facing the cucurbit industry, and vegetable agriculture in general, is the accidental introduction of new viruses to new regions through the movement of either infected but symptomless transplants, or the movement of viruses in plants not previously known to be hosts of the virus. It is important to know which viruses are of concern to an industry, and to make sure that all elements of the industry work in a coordinated manner to limit the movement of infected materials. One means by which this can be done is through the use of a system such as this that can be performed efficiently, with limited expense, by a diagnostic lab to test any suspected plant materials or to simply verify the virus-free status of plants being transported between regions. CYSDV and CCYV offer a particular challenge. Both viruses, like other members of the genus Crinivirus, have a latent period of approximately three weeks from infection until symptoms develop, and virus titers accumulate gradually over this time as well (Tzanetakis et al. 2013; Wintermantel et al. 2017). The availability of multiplex RT-PCR for use by diagnostic labs can assist nurseries to determine infection prior to shipment. If there is concern that a recent whitefly infestation may have introduced a virus, the RT-qPCR system will detect much lower titers and earlier infections. This can reduce spread in nursery materials. Similarly, scientists should monitor known hosts and particularly critical reservoir hosts in a region for these viruses and the system can identify these as well.

Another advantage of this system is its adaptability. There are several cucurbit viruses that are unique to individual production regions around the world. CYSDV is now fairly widely distributed in cucurbit-growing regions. CCYV is rapidly spreading and is often masked by the presence of CYSDV when both viruses are present together. As mentioned previously, this complicates diagnosis and efforts at breeding for the development of resistant cultivars because CCYV can remain undetected in areas where it had been introduced because of similarity in symptoms to those of CYSDV. As noted above, CCYV was present for a few years in southern California melon fields prior to its first detection (Wintermantel et al. 2019). A similar situation occurs with the aphid-transmitted CABYV, which produces identical symptoms on cucurbit hosts to those caused by CYSDV and CCYV. The latter two viruses were recently identified in the San Joaquin Valley (southern Central Valley) of California (Mondal et al. 2021b), and with all three yellowing viruses present in the same region, it is of critical importance to have efficient diagnostic methods that can differentiate these viruses from one another. Similarly, CCYV was recently identified in Georgia (Kavalappara et al. 2021b), where CYSDV has been present for a few years, and both viruses were recently detected in Alabama (Mondal et al. 2022). Other viruses are also frequently present in United States cucurbit fields. SqVYV is an important pathogen of watermelon, and although it is of minor concern for melon production, it is important to know whether SqVYV is present as it could impact nearby watermelon crops. All three of the whitefly-transmitted yellowing viruses (CYSDV, CCYV, and CABYV) are now present in the southeastern United States as well, where a much higher percentage of cucurbit production is focused on watermelon (Citrullus lanatus), squash (Cucurbita pepo), and pumpkin (C. pepo, C. maxima, and C. moschata). Therefore, monitoring for SqVYV along with CYSDV and CCYV, which can mask SqVYV symptoms due to the intensity of their own symptoms, is of crucial importance for regional virus management. The multiplex detection and quantification method developed herein is sensitive, economical, and adaptive. It is possible that appropriate adjustments, including reaction volume, could be made to optimize for the addition of other viruses to the multiplex system, but in most cases it may be more appropriate to determine what the major threats are in a region and adapt this system for regionally important virus threats.

While this multiplex system has been validated using the complement of viruses most prevalent in the Sonoran Desert melon production region of the southwestern United States, new studies are already beginning to apply the approach in additional regions, including the Central Valley of California (Mondal et al. 2021b) and portions of the southeastern United States (Kavalappara et al. 2021a, b; Mondal et al. 2022), where these viruses have been recently reported. Multiplex detection and quantification limit the need for multiple RT-PCR reactions targeting individual viruses, reducing both time and the higher cost associated with independent molecular detection of viruses. The application of single-step approaches to both the multiplex RT-PCR and RT-qPCR methods can reduce cDNA synthesis steps compared with the more traditional two-step methods and can facilitate high-throughput testing. Furthermore, validation of the single step RT-qPCR method in a lower reaction volume justifies its potential to test a greater number of viruses in short timeframe and with reduced cost. The ability to quickly compare titers of four target viruses in a single sample can greatly expedite breeding and diagnostic efforts even in areas impacted by multiple viruses with similar symptoms.

Acknowledgments

The authors thank John Palumbo and Bindu Poudel-Ward, University of Arizona Extension; Oli Bachie, Apurba Barman, and Tom Turini, University of California Extension; and James D. McCreight and Patricia Fashing, USDA-ARS, Salinas, for coordination of and assistance with collection of field samples. The authors also thank Carol Chen, Misael Saenz Rodriguez, Arturo Cortez, and Aaron Rocha, USDA-ARS, Salinas, for technical assistance.