Biological Characteristics and Molecular Mechanism of Fludioxonil Resistance in Botrytis cinerea From Henan Province of China

Botrytis cinerea Pers (teleomorph Botryotinia fuckeliana Whetzel) is a ubiquitous necrotrophic plant pathogen belonging to the Ascomycota (van Kan et al. 2017). It infects >1,400 crop species and predominantly affects dicotyledonous species, especially those that bear soft fruits, such as tomatoes and strawberries (Elad et al. 2007; Staats et al. 2005; van Kan 2006; van Kan et al. 2017; Williamson et al. 2007). Disease management in greenhouse crops is highly dependent on the application of fungicides, which are crucial to ensure sustainable production of tomatoes. Commonly used fungicide groups include the benzimidazoles, dicarboximides, carbamates, quinone outside inhibitors, sterol biosynthesis inhibitors, anilinopyrimidines, succinate dehydrogenase inhibitors, and phenylpyrroles (Amiri et al. 2013; Rosslenbroich and Stuebler 2000; Zhang and Ma 2014; Zhou et al. 2017). However, owing to its short lifecycle, high genetic variability, and abundant reproductive capacity, B. cinerea is well known as a high-risk pathogen for the development of fungicide resistance (Leroux et al. 2002; Sang et al. 2018). Indeed, there have been many reports of highly resistant isolates of B. cinerea in China arising from excessive or inappropriate uses of fungicides, which have jeopardized the effectiveness of a broad range of fungicides, including carbendazim, iprodione, procymidone, diethofencarb, pyrimethanil, cyprodinil, and fenhexamid (Hu et al. 2011; Liu et al. 2003; Zhang et al. 2003, 2013; Zhou et al. 2017).

Fludioxonil is a member of the phenylpyrrole fungicides. Although the mode of action has not been fully revealed, it is believed that fludioxonil is involved in the high-osmolarity glycerol (HOG) stress response signal transduction pathway (Qiu et al. 2018). Phenylpyrroles exhibit broad-spectrum activity against a variety of fungal pathogens and have been used in >900 agricultural products (Brandhorst and Klein 2019; Yoshimi et al. 2005). Although fludioxonil has been widely used for the control of numerous plant pathogens over the past 30 years, it was only registered in China for the control of gray mold in 2018 (Sang et al. 2018). The reports of fludioxonil-resistant B. cinerea isolates are, therefore, of great concern (Amiri and Peres 2014; Amiri et al. 2013, 2014; Sang et al. 2018). Some previous studies have shown that fludioxonil-resistant isolates have reduced fitness associated with an increased sensitivity to high osmotic stress, which is consistent with the biochemical mechanism of fludioxonil that is known to inhibit the HOG cascade of mitogen-activated protein kinase (MAPK) signaling pathway (Lew 2010; Sang et al. 2018). Indeed, there have been several reports of specific amino acid mutations and genetic polymorphism in the MAPK BOs1 (BC1G_00374) of B. cinerea that linked to fludioxonil resistance (Gong et al. 2018; Sang et al. 2018). For example, mutations have been identified in the ATPase domain of the C terminus from high-resistance laboratory strains of B. cinerea, whereas mutations in low-resistance field populations of B. cinerea are mainly distributed in the histidine kinases, adenylyl cyclases, methyl-accepting chemotaxis receptors, and phosphatases (HAMP) domain in the N terminus of osmosensing histidine kinase, which is considered to be the fungicide binding site (Ren et al. 2016; Sang et al. 2018). Similar results have also been found in many other plant pathogenic fungi, where induced amino acid changes in the BOs1 protein as a result of ultraviolet treatment or repeated exposure to fludioxonil have been associated with high levels of resistance (Avenot and Michailides 2015; Dry et al. 2004; Duan et al. 2014; Han et al. 2017; Jung et al. 2012; Li and Xiao 2008; Peters et al. 2008; Ren et al. 2016; Tückmantel et al. 2011; Wu et al. 2015). However, it is interesting to note that only a low level of fludioxonil resistance has been detected in field populations (Avenot and Michailides 2015; Dry et al. 2004; Duan et al. 2014; Han et al. 2017; Jung et al. 2012; Li and Xiao 2008; Peters et al. 2008; Ren et al. 2016; Tückmantel et al. 2011; Wu et al. 2015). There have been insufficient studies to determine whether cross-resistance with other common fungicides can be directly linked to fludioxonil resistance in B. cinerea, although previous reports of fludioxonil resistance have indicated a degree of cross-resistance with a range of fungicides, including tolclofos-methyl, vinclozolin, and iprodione. In addition, fludioxonil resistance has been found to result in increased sensitivity to some antifungal compounds, such as pyraclostrobin (Malandrakis et al. 2013).

These results indicate that further investigation of the biological characteristics and molecular mechanism of fludioxonil-resistant isolates is needed to fully understand the mechanisms of resistance in different populations. The specific objectives of this study were, therefore, to (1) compare the fitness and physiological characteristics of different fludioxonil-resistant and -sensitive isolates, (2) assess the potential for cross-resistance between fludioxonil and other widely used fungicides, and (3) investigate molecular mechanisms of fludioxonil resistance.

Materials and Methods

Isolates of B. cinerea, media, and culture conditions.

The pathogen isolates used in this study were collected from infected greenhouse tomatoes in Xinxiang city, Henan Province of China in 2018. Eight isolates were collected from infected tomato leaves from different greenhouses. All of the B. cinerea isolates were first purified by single-spore isolation and thereafter, maintained on potato dextrose agar (PDA; 200 g/liter of potato, 20 g/liter of agar, and 20 g/liter of dextrose). After approximately 6 days of dark incubation at 22°C, conidial suspensions were prepared in 20% sterile glycerol and stored at −20°C until use (Zhou et al. 2017). Four laboratory fludioxonil-resistant strains (XXtom-Lab1, XXtom-Lab3, XXtom-Lab4, and XXtom-Lab5 laboratory induced from their parental isolates XXtom1801, XXtom1803, XXtom1804, and XXtom1805, respectively, by fludioxonil taming) were evaluated. The mycelia were used to determine intracellular glycerol accumulation and enzyme activity. For genomic DNA, extractions were prepared by inoculating 200 ml of potato dextrose broth (PDB), which was dark incubated at 22°C for 72 h with shaking (130 rpm), before the samples were prepared in the absence or presence of 0.1 μM fludioxonil. After a further 5 h of incubation, the mycelium was collected and flash frozen in liquid nitrogen according to the protocol of a previous study (Qiu and Shi 2014; Qiu et al. 2018).

Fungicides.

Technical-grade concentrates of the fungicides listed in Table 1 were dissolved in either acetone to produce 10-mg/ml stock solutions or in the case of carbendazim, 0.1 mol/liter of hydrochloric acid. The stock solutions were stored at 4°C. Preliminary tests confirmed that neither of the solvents used had a significant effect on the mycelial growth of B. cinerea at the concentrations that were used in this study (data not shown).

Table 1. Fungicides used in this study

Common name	Fungicide group	Mode of action	FRACz code	Source	Solvent
Iprodione (95.3%)	Dicarboximide	Inhibition of mitochondrial respiration	2	Heyi Agrochemical Co. Ltd.	Acetone
Procymidone (98.0%)
Carbendazim (98.1%)	Methyl benzimidazole carbamate	Inhibition of β-tubulin assembly in mitosis	1	Haili Guixi Chemical Co. Ltd.	0.1 mol/liter of hydrochloric acid
Fludioxonil (96.0%)	Phenylpyrrole	Inhibition of mitochondrial respiration	12	Hubei Jianyuan Chemical Co. Ltd.	Acetone
Tebuconazole (96.2%)	14α-Demethylase inhibitors	Inhibition of C14α-demethylase in sterol biosynthesis	3	Sheyang Huanghai Pesticide Chemical Co. Ltd.	Acetone
Boscalid (97.0%)	Carboxamide	Inhibition of mitochondrial respiration	7	Kangbaotai Fine-Chemical Co. Ltd.	Acetone
Fluazinam (95%)	2,6-Dinitroanilines	Inhibition of mitochondrial respiration	29	Zhejiang Heben Pesticide & Chemicals Co. Ltd.	Acetone

^zFRAC, Fungicide Resistance Action Committee.

View as image HTML

Identification of fludioxonil-resistant strains of B. cinerea.

A protocol used in previous studies was modified to identify fludioxonil-resistant isolates of B. cinerea (Ma et al. 2009; Zhou et al. 2014). Fungal cultures were first established on PDA and incubated for 48 h at 22°C in a growth chamber with a 12-h photoperiod. Mycelial plugs (5 mm in diameter) were then excised from the colony margins and inverted on fresh PDA containing 5 μg/ml of fludioxonil (discriminatory dose). Negative controls were prepared using identical plates that contained no fludioxonil. The mycelial growth of the resulting colonies was assessed after 48 h of incubation at 22°C by measuring their diameters in two perpendicular directions. Isolates capable of growing on PDA media containing 5 μg/ml of fludioxonil were tentatively considered fludioxonil resistant, whereas those unable to grow were designated fludioxonil sensitive (Ma et al. 2009; Zhou et al. 2014). The resistant isolates identified in the first round of screening were then assessed further to determine their 50% effective concentration (EC₅₀) values (effective concentration inhibiting 50% of colony growth) in accordance with the method used in a previous study (Liang et al. 2015) and fludioxonil at the following concentrations: 0, 0.25, 0.5, 1, 2, 4, 8, 16, 32, 64, and 128 μg/ml. Each treatment consisted of three replicate plates, and the whole experiment was conducted twice. The EC₅₀ values were determined using linear regression of log₁₀ fungicide concentrations versus the percentage growth inhibition. The resistance factor (RF) of the resistant isolates was then calculated using the following formula:

RF = EC₅₀ value of resistant isolate/average EC₅₀ value of sensitive isolates tests

Biological characteristics of fludioxonil-resistant strains of B. cinerea.

Mycelial growth.

The mycelial growth of the fludioxonil-resistant B. cinerea isolates was assessed using the method of Zhou et al. (2014), with a few modifications. In total, nine isolates were assessed; four fludioxonil-sensitive isolates (XXtom1801, XXtom1802, XXtom1803, and XXtom1804), one fludioxonil-resistant field isolate (XXtom1806), and four fludioxonil-resistant laboratory strains (XXtom-Lab1, XXtom-Lab3, XXtom-Lab4, and XXtom-Lab5) were evaluated. Mycelial plugs (5 mm) were excised from the edge of 2-day-old colonies and inverted onto fresh PDA plates. The colonies were incubation at 22°C with a 12-h photoperiod, and their diameters were measured at 24, 48, and 72 h postinoculation. Each isolate was represented by six replicate plates, and the complete experiment was performed twice.

Sporulation.

The sporulation of the B. cinerea isolates was investigated using a slightly modified version of the Zhou et al. (2017) method. Sensitive and fludioxonil-resistant isolates were first inoculated to the center of fresh PDA plates using mycelial plugs from 72-h-old PDA cultures and dark incubated at 22°C. After 48 h, the developing cultures were switched to a 14-h dark/10-h light regime for another 10 days of incubation. Each plate was then flooded with 20 ml of distilled water, and the spores were collected by scraping the surface of the plate and aspiration. Spores were harvested and numbered using a hemocytometer (Shanghai Qiujing Biochemical Reagent Instrument Co., Ltd.). Each isolate was represented by three replicated plates, and the whole experiment was performed twice.

Sensitivity to osmotic stress.

Plate assays were used to determine the response to osmotic stress using a modified version of a method described in previous studies (Zhou et al. 2014, 2017). Colonies of the sensitive and resistant B. cinerea isolates were first established on fresh PDA plates amended with either NaCl (at 0, 1.25, 2.5, 5.0, 10, 20, 40, 80, and 160 g/liter) or glucose (at 0, 10, 20, 40, 80,100, 150, 200, and 400 g/liter) by inoculation with mycelial plugs from 72-h-old PDA cultures. The percentage radial growth inhibition relative to the negative control, which consisted of identical cultures grown on PDA free of NaCl and glucose, was calculated from radial growth measurements taken after 48 h of incubation at 22°C with a 12-h photoperiod. Each treatment consisted of six replicate plates, with the whole experiment being performed twice.

Pathogenicity on tomato leaves.

A total of nine B. cinerea isolates were assessed: one fludioxonil-resistant field isolate, four fludioxonil-sensitive laboratory strains, and four sensitive isolates. Detached tomato leaves (cultivar Zhongshu number 4) of similar size and growth stage were first excised from tomato plants, rinsed with sterile water, air dried in a transfer hood, and transferred to 15-cm petri dishes lined with wet filter paper to maintain high humidity before being inoculated on their adaxial surfaces with mycelial plugs (6 mm in diameter) cut from the margins of 24-, 48-, and 72-h-old colonies of each B. cinerea isolate. The inoculated leaves were incubated in a growth chamber (22°C; photoperiod of 16 h) for 72 h. The resulting lesions were measured at 24, 48, and 72 h postinoculation. Each isolate was represented by at least eight leaves, and the entire experiment was performed twice (Zhou et al. 2014, 2017).

Peroxidase extraction and measurement.

The peroxidase (POD) extractions and assays (Li et al. 2017) were performed using fresh mycelial samples (0.1 g) that had been ground in liquid nitrogen and suspended in 0.9-ml aliquots of 10 mM phosphate buffer (pH 7.4). The homogenate was then centrifuged at 2,500 rpm for 10 min at 4°C before the resulting supernatant was collected and assessed for POD activity using a commercial assay kit (Nanjing Jiancheng Bioengineering Institute), and a microplate reader (Varioskan Flash). The POD activity was estimated from the changes in absorbance at 420 nm resulting from the catalysis of the H₂O₂ substrate. One unit was defined as the amount of enzyme that catalyzed 1 µg of substrate per 1.0 g of fresh tissue at 37°C. The POD activity was calculated using the formula provided by the assay kit manufacturer. Each isolate was represented by three replicate samples, and the entire experiment was performed twice.

Determination of glycerol content.

The intracellular glycerol accumulation analysis was conducted using 75 ml of PDB inoculated with a single mycelial plug. The test cultures were dark incubated for 3 days at 22°C with shaking at 150 rpm before 0.1 μg/ml of fludioxonil was added to the positive treatments. After another 5 h of incubation, the mycelium from each culture was collected, ground with a grinder in liquid nitrogen, and transferred to glycerol extraction buffer. The glycerol content was then measured using a commercial glycerol assay kit (Applygen) according to the instructions of the manufacturer. Each isolate was represented by three replicate samples, and the entire experiment was performed twice.

Amplification and sequencing of the BOs1 gene.

Total genomic DNA was extracted from fresh mycelia according to the protocol of a previous study (Milvia et al. 2014) and used as a template for the amplification of the BOs1 gene using four primer pairs developed in a previous study (Gong et al. 2018), BOs1F1/BOs1R1, BOs1F2/BOs1R2, BOs1F3/BOs1R3, BOs1F4/BOs1R4, and BOs1F5/BOs1R5, which had the following sequences: TACCGATCGAAAAACCCAAC/TGGGCTGGTCTCTCAATCTT, CAACGTTATGGCACAAAATCTCA/AAGTTTCTGGCCATGGTGTTCA, GGTCGGAACTGATGGAACTC/CGCGGTAAGTGAGGTCTAGG and GCAAACCGTATGATCATGGA/AGCTCGATTCTCCAAAGCAG, TCCCGTTATTCATGTCAGCTT/AAGTACTCGCAGTCGGTGGT, respectively. The PCRs were performed using 50-μl reaction mixtures containing 25 μl of 2×ES Taq Master Mix, 1.5 μl of template DNA, 2 μl of each primer, and 21.5 μl of ddH₂O (CoWin Biosciences) in a 96-well thermal cycler (Applied Biosystems; Thermo Fisher Scientific) with the following program: an initial denaturation at 94°C for 2 min followed by 35 cycles of 94°C for 30 s, 57°C for 30 s, and 72°C for 1.5 min and a final extension at 72°C for 10 min. The resulting PCR products were purified, cloned into the pMD19-T vector, and sequenced (Wuhan Genecreate Biotechnology Co. Ltd.). The resulting sequence data were analyzed using the DNAMAN software package (ver.8.0. Lynnon Biosolf; American) to produce multiple sequence alignments that were used to identify amino acid sequence differences between the resistant and sensitive isolates as described in previous studies (Gong et al. 2018; Zhou et al. 2017).

Cross-resistance of fludioxonil-resistant strains to other fungicides.

The mycelial growth assay described above was also used to test for cross-resistance between fludioxonil and a range of fungicides, including procymidone, iprodione, boscalid, carbendazim, tebuconazole, and fluazinam. PDA medium was amended with 0, 0.0625, 0.0125, 0.025, 0.05, 0.1, 0.2, 0.4, 0.8, and 1.6 μg/ml of boscalid, carbendazim, tebuconazole, and fluazinam and amended with 0, 1.5625, 3.125, 6.25, 12.5, 25, 50, and 100 μg/ml for fludioxonil, procymidone, and iprodione. Each treatment consisted of at least three replicate plates, with the whole experiment being performed twice.

Statistical analysis.

Data collected during the study were evaluated by analysis of variance using SPSS software (ver. 17.0; SPSS Inc.), with statistical differences between individual treatments being assessed using Fisher’s least significant difference test (α = 0.05 and α = 0.01). The sequence of the amino acid sequences was analyzed using DNAMAN software (Version 6.0; Lynnon Biosoft).

Results

Biological characteristics of fludioxonil-resistant B. cinerea strains.

The mycelial growth of all of the fludioxonil-resistant isolates was significantly reduced relative to the sensitive isolates, particularly for the resistant field isolate XXtom1806 (Table 2). Although the sporulation of the fludioxonil-resistant laboratory strains was similar to the sensitive isolates, the resistant field isolate XXtom1806 had significantly reduced (P < 0.05) sporulation. However, the pathogenicity of all of the fludioxonil-resistant isolates was significantly reduced, with XXtom1806 completely losing pathogenicity on detached leaves of tomato (Table 2). All of the fludioxonil-resistant isolates were much more sensitive to osmotic stress than the sensitive ones. The resistant strains exhibited greatly reduced rates even at low concentrations of NaCl (2.5 to 20 g/liter) and glucose (10 to 100 g/liter) (Fig. 1).

Table 2. Mycelial growth, sporulation, and pathogenicity of sensitive and fludioxonil-resistant strains of Botrytis cinerea

Strains (EC50)x	Phenotype	Mycelial growth, cm ± standard errory			Sporulation, spores per 1 mly	Lesion diameter, cmy
		24 h	48 h	72 h		24 h	48 h	72 h
XXtom1801 (0.073)	Sensitive	1.37 ± 0.03 cC	3.43 ± 0.12 cCD	4.77 ± 0.09 cB	577.66 ± 21.54 cd C	0.53 ± 0.03 c BC	1.13 ± 0.12 de DE	2.53 ± 0.20 dD
XXtom1802 (0.065)	Sensitive	1.67 ± 0.12 dD	3.00 ± 0.11 bBC	4.87 ± 0.15 cB	526.33 ± 42.98 cd BC	0.57 ± 0.03 c C	1.37 ± 0.03 ef E	1.73 ± 0.12 c BC
XXtom1803 (0.030)	Sensitive	1.70 ± 0.06 dD	4.03 ± 0.03 dE	5.77 ± 0.09 dC	570.67 ± 37.65 cd C	0.53 ± 0.03 c BC	1.20 ± 0.06 def DE	2.30 ± 0.21 d CD
XXtom1804 (0.025)	Sensitive	1.80 ± 0.06 dD	3.87 ± 0.09 d DE	5.73 ± 0.15 dC	472.67 ± 34.37 bc BC	0.53 ± 0.03 c BC	1.43 ± 0.12 f E	2.60 ± 0.06 dD
XXtom1806 (18.06)	Resistant	0.90 ± 0.01 aA	2.57 ± 0.09 a AB	4.10 ± 0.15 abA	9.33 ± 2.33 a A	–z a A	–z a A	–z a A
XXtom-lab1 (>100)	Resistant	1.07 ± 0.03 ab AB	2.53 ± 0.12 a AB	3.83 ± 0.09 aA	494.67 ± 19.15 bcd BC	–z a A	0.77 ± 0.09 bc BC	1.17 ± 0.17 b B
XXtom-lab3 (68.46)	Resistant	1.10 ± 0.10 ab ABC	2.77 ± 0.17 ab AB	4.03 ± 0.07 abA	408.67 ± 11.55 b B	–z a A	0.97 ± 0.07 cd CD	1.50 ± 0.15 bc B
XXtom-lab4 (>100)	Resistant	1.23 ± 0.03 bc BC	2.50 ± 0.15 a AB	3.83 ± 0.09 aA	587.33 ± 29.17 d C	0.50 ± 0.06 c BC	0.63 ± 0.09 b B	1.53 ± 0.23 bc B
XXtom-lab5 (>100)	Resistant	0.95 ± 0.09 aAB	2.40 ± 0.15 aA	4.23 ± 0.18 bA	522.33 ± 54.23 cd BC	0.30 ± 0.15 b B	0.57 ± 0.03 b B	1.43 ± 0.12 bc B

^xThe 50% effective concentration (EC₅₀) values for fludioxonil.

^yDifferent letters in the same column indicate significant differences according to Fisher’s least significant difference test (α = 0.05 and α = 0.01).

^zNo infection.

View as image HTML

Download as PowerPoint

Glycerol content and POD activity of fludioxonil-resistant B. cinerea strains.

The glycerol content of all fludioxonil-resistant strains increased significantly compared with the sensitive isolates when grown in PDB in the absence of fludioxonil (Fig. 2A). However, the addition of 0.1 μg/ml of fludioxonil significantly (P < 0.05) increased glycerol levels of the sensitive isolates XXtom1801, XXtom1802, XXtom1803, and XXtom1804 by 63.13, 32.98, 40.90, and 59.93%, respectively. Although the fludioxonil treatment did significantly (P < 0.01) increase the glycerol levels of the resistant strains, the effect was less dramatic, with increases of just 12.63, 11.08, 20.50, 11.92, and 15.78% for isolates XXtom1806, XXtom-lab1, XXtom-lab3, XXtom-lab4, and XXtom-lab5, respectively (Fig. 2A).

Download as PowerPoint

Similar results were also observed with regard to POD activity, with the fludioxonil-resistant isolates having significantly (P < 0.01) higher POD activities than the sensitive isolates when grown in PDB in the absence of fludioxonil, and the POD activities of the XXtom1806, XXtom-lab1, XXtom-lab3, XXtom-lab4, and XXtom-lab5 strains increased 6.19-, 6.75-, 3.11-, 1.37-, and 7.15-fold, respectively, compared with those of sensitive isolates (average value) (Fig. 2B). However, for the sensitive isolates XXtom1801, XXtom1802, XXtom1803, and XXtom1804, the POD activities increased 4.73-, 9.85-, 9.02-, and 5.32-fold, respectively, compared with those in the absence of fludioxonil, which exhibited a much greater increase in POD activity (P < 0.01) than those of resistant strains on the addition of 0.1 μg/ml of fludioxonil (Fig. 2B).

Sequence analysis of the BOs1 gene in fludioxonil-resistant strains of B. cinerea.

The four sensitive isolates had identical BOs1 sequences, whereas four of the resistant strains (XXtom1806, XXtom-lab1, XXtom-lab3, and XXtom-lab4) contained several changes, including point mutations, that have been previously associated with fludioxonil resistance (Table 3). The fludioxonil-resistant field isolate XXtom1806 had four point mutations corresponding to the following amino acid changes: I365S, S531G, T565N, and T1267A; three of these were located in the six HAMP domains, whereas the fourth, T1267A, was in the C terminus of the BoS1 protein. In contrast, the laboratory strain XXtom-lab3 had a 52-bp insertion encoding 16 amino acids at amino acid position 240, resulting in a premature stop codon at amino acid position 256, whereas the laboratory strain XXtom-Lab1 had point mutations of Q846S and I1126S, and XXtom-Lab4 had point mutations of G415D, P1051S, and V1241M. The G415D and Q846S changes resided in the six HAMP domains, and the I1126S and V1241M resided in the HATPase_C domain and the C terminus of BoS1, respectively, whereas P1051S is located between the HATPase_C domain and the Rec domain of BoS1. The BOs1 gene of the laboratory strain, XXtom-lab5, was identical to the sequences of the sensitive isolates, which indicates that the observed resistance in this isolate could result from an alternative resistance mechanism.

Table 3. Mutations in the BOs1 protein sequence of fludioxonil-resistant strains of Botrytis cinerea and Bipolaris maydis

Species	Resource	Resistance typey	Mutations	Structural domainz	Reference
B. cinerea	Laboratory	LR	No mutation	–	Ren et al. (2016)
B. cinerea	Field	LR	F127S, V287G, I365N, I365S, V1136I, A1259T	N terminus, HAMP, Rec, and C terminus	Gong et al. (2018)
B. cinerea	Field	MR	F127S, V287G, I365N, V1136I, A1259T	N terminus, HAMP, Rec, and C terminus	Gong et al. (2018)
B. cinerea	Field	HR	I365S, V1136I, A1259T	HAMP, Rec, and C terminus	Gong et al. (2018)
B. cinerea	Laboratory	HR	Q846stop, E253D, 838stop, G415D	HATPase_c, HAMP	Ren et al. (2016)
B. cinerea	Field	HR	R319K, V336M, D337 N, V346I, A350S, Q369P, N373S, G262S, Q369P, N373S, G311R, G265D, N609T, G545E	HAMP	Ren et al. (2016)
B. cinerea	Field	HR	I365S, S531G, T565N, T1267A	HAMP, C terminus	This study
B. cinerea	Laboratory	HR	No mutation, G415D, P1051S, V1241M, 240stop, Q846S, I1126S	HAMP, HATPsae_c, C terminus	This study
B. cinerea	Field	HR	F127S, I365N, S426P, G538R, A1259T	N terminus, HAMP, C terminus	Sang et al. (2018)
B. maydis	Laboratory	HR	Z1125K, 34-bp deletion fragment	Rec domain	Han et al. (2017)

^yResistance level indicating degree of sensitivity to fludioxonil. HR, high resistance; LR, low resistance; MR, medium resistance.

^zDomain characteristics according to Ren et al. (2016). HAMP, histidine kinases, adenylyl cyclases, methyl-accepting chemotaxis receptors, and phosphatases.

View as image HTML

Cross-resistance with other fungicides in fludioxonil-resistant strains.

There was a positive cross-resistance between fludioxonil, procymidone, and iprodione (Table 4). This is not surprising, because procymidone and iprodione both belong to the dicarboximide group of fungicides, which share the same mode of action targeting the mitogen-activated protein histidine kinase in the HOG1 signal transduction pathway. No cross-resistance was found between fludioxonil and any of the other fungicides tested, including boscalid, carbendazim, tebuconazole, and fluazinam (Table 4).

Table 4. The 50% effective concentration values of Botrytis cinerea isolates to fludioxonil and select fungicides

Fungicides	Fludioxonil-sensitive isolates				Fludioxonil-resistant strains
	XXtom1801	XXtom1802	XXtom1803	XXtom1804	XXtom1806	XXtom-Lab1	XXtom-Lab3	XXtom-Lab4	XXtom-Lab5
Fludioxonil	0.073	0.065	0.030	0.025	18.06	>100	68.46	>100	>100
Procymidone	0.352	0.463	0.422	0.769	36.876	>50	>50	78.65	>50
Iprodione	0.869	1.768	0.723	1.364	0.987	96.78	68.96	>50	>50
Boscalid	0.098	0.135	0.075	0.011	0.163	0.215	0.07	0.31	0.263
Carbendazim	0.73	0.54	0.63	0.35	0.62	0.46	0.33	0.71	0.29
Tebuconazole	0.185	0.026	0.082	0.116	0.076	0.074	0.211	0.075	0.112
Fluazinam	0.096	0.037	0.134	0.008	0.091	0.010	0.163	0.045	0.034

View as image HTML

Discussion

Fludioxonil is a phenylpyrrole fungicide that exhibits broad-spectrum activity against a variety of fungal pathogens (Brandhorst and Klein 2019; Yoshimi et al. 2005). Previous studies have shown that fludioxonil-resistant isolates often exhibit high sensitivity to osmotic stress. The biochemical action mechanism of fludioxonil is known to involve the inhibition of the HOG1 cascade of the MAPK signaling pathway, and previous studies have indicated that alterations to the BOs1 gene in B. cinerea are strongly linked to fludioxonil resistance (Lew 2010; Sang et al. 2018). This study evaluated a total of nine B. cinerea isolates, including four sensitive isolates, one fludioxonil-resistant field isolate (XXtom1806), and four resistant laboratory strains (XXtom-lab1, XXtom-lab3, XXtom-lab4, and XXtom-lab5). Compared with the sensitive isolates, the fludioxonil-resistant isolates exhibited reduced mycelial growth, sporulation, and pathogenicity, suggesting that fludioxonil resistance has a negative effect on fitness, which perhaps explains the relatively low occurrence of resistant isolates in the field (Qiu et al. 2018). Reduced fitness has been reported in several previous studies of fludioxonil resistance in B. cinerea (Gong et al. 2018; Qiu et al. 2018; Ren et al. 2016) as well as in dimethachlon-resistant isolates of Sclerotinia sclerotiorum and fenhexamid-resistant isolates of B. cinerea (Zhou et al. 2014, 2017). Taken together, these results indicate that the influence of fungicides resistance on fitness parameters is primarily determined by particular resistance mechanisms and target genes rather than by the species of fungus (Qiu et al. 2018).

Although the mode of action of fludioxonil is still not characterized in detail, it seems that the target of fludioxonil is the HOG1 cascade of the MAPK signaling pathway (Brandhorst and Klein 2019; Gong et al. 2018; Qiu et al. 2018; Ren et al. 2016). The results of this study confirmed that both the fludioxonil-resistant field isolate and the resistant laboratory strains exhibited hypersensitivity to the adverse osmotic conditions imposed by NaCl and glucose. The fitness of resistant isolates is an extremely important factor regarding the risk for the development of fungicide resistance (Brent and Hollomon 2007).

POD is one of the key protective enzymes associated with pathogenesis of fungi (Duan et al. 2014; Prestamo and Manzano 1993; Yao and Tian 2005). It is, therefore, interesting to note that POD activity is higher in the fludioxonil-resistant mutants compared with sensitive isolates in both B. cinerea and S. sclerotiorum (Duan et al. 2014; Gong et al. 2018; Li et al. 2017). This study confirmed these observations, finding that the resistant isolates had much higher POD activity than the sensitive ones and that fludioxonil at 0.1 μg/ml increased POD activity, particularly in the sensitive isolates. Taken together, these results provide further evidence of the link between fludioxonil resistance and POD activity and indicate that altered POD activity could be another contributing factor in the reduced fitness of fludioxonil-resistant B. cinerea isolates.

There is growing evidence that mutations in fungal MAPK proteins can contribute to fludioxonil resistance. For example, mutations in the N-terminal region of Os1 have been related to fludioxonil resistance in several species of fungi (Avenot et al. 2005; Ren et al. 2016), whereas numerous studies have documented a range of mutations in the fludioxonil target protein BOs1 that can lead to the fludioxonil resistance (Table 3). This study also found that the fludioxonil-resistant field isolate (XXtom1806), which was collected from Xinxiang city of Henan Province, contained an amino acid change of I365S as well as three changes (S531G, T565N, and T1267A) that have not previously been documented in Henan Province (Ren et al. 2016). Furthermore, all of the four mutations were located in the functional domain of the HAMP motif in the fludioxonil-resistant field isolate, providing strong evidence that this isolate obtains resistance via impaired binding of fludioxonil to its target protein site, a mechanism that has been reported previously (Gong et al. 2018). However, the observation that the fludioxonil-resistant laboratory strains contained other amino acid changes indicates alternative resistant mechanisms, which could also explain the different degrees of resistance observed among the different isolates. For example, the laboratory strain XXtom-lab5 contained no amino acid changes in its BOs1 gene at all but exhibited high levels of resistance, indicating that other mechanisms, such as detoxification, are important aspects of fludioxonil resistance in B. cinerea and that further molecular and genetic analyses are needed to fully characterize the molecular mechanisms of fludioxonil resistance. In addition, the results of this study found strong evidence of positive cross-resistance between fludioxonil and the dicarboximide fungicides procymidone and iprodione, which is not surprising given their similar mode of action. Meanwhile, no cross-resistance was found between fludioxonil and any of the other fungicides tested, including boscalid, carbendazim, tebuconazole, and fluazinam (Table 4). These results indicated that the inclusion of the latter fungicides within an integrated pest management program could help to minimize the risk of fludioxonil resistance developing.