DISEASE NOTESOpen Access icon OPENOpen Access license

First Report of Grapevine virus B Infecting Muscadine (Vitis rotundifolia) in the United States

    Affiliations
    Authors and Affiliations
    • S. Sabanadzovic , Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology
    • N. Aboughanem-Sabanadzovic , Institute for Genomics, Biocomputing and Biotechnology, Mississippi State University, Mississippi State 39762.

      Muscadine (Vitis rotundifolia) is native to the southeastern United States and is the primary grape grown in several states (e.g., Mississippi, Georgia, and Louisiana). Despite the economic importance of muscadine grape in this region, knowledge about viruses affecting this crop is very limited (Sabanadzovic et al. 2009; Aboughanem-Sabanadzovic and Sabanadzovic 2015). A statewide survey aimed at the identification of viruses infecting muscadine in Mississippi was carried out in 2012 and 2013. In the initial phase of the survey, dsRNA was extracted from 20 muscadine samples. Purified extracts were reverse transcribed and subjected to PCR with several taxon-specific degenerate primers (i.e., potyvirus, tymovirus, closterovirus, flexivirus, and nepovirus). A DNA band of the expected size was amplified with flexivirus-specific primers (Dovas and Katis 2003) from a sample of an unknown cultivar collected from a backyard in central Mississippi. The 363-bp amplicon was cloned, sequenced, and submitted to GenBank (KT933074). Sequence analysis showed 80% and 93% identity with Grapevine virus B (GVB) from Italy (GenBank no. X75448) (Saldarelli et al. 1996) at the nucleotide and amino acid levels, respectively. In order to further this study, a set of GVB-specific primers (GVBmusc-F 5′GCTTGCTTCTGTCATGCAGT3′ and GVBmusc-R 5′AACTGCGAGATTTCCCATACT3′) was designed and applied in one-step RT-PCR on total nucleic extracts from 70 additional plants collected randomly statewide. GVB was detected in four additional samples, all belonging to cv. Burgaw collected from the same research plot located in southern Mississippi. Curiously, one of these samples was found infected with Grapevine leafroll-associated virus 2 (GLRaV-2) in our previous study (Aboughanem-Sabanadzovic and Sabanadzovic 2015). This fact prompted additional tests, which showed that all four GVB-positive plants were also coinfected with GLRaV-2. In order to verify RT-PCR results, a digoxigenin (DIG)-labeled DNA probe was synthesized on a fragment of viral RNA-dependent RNA polymerase gene according to manufacturers instructions (Roche Diagnostics, Indianapolis, IN), and used in dot-blot hybridization on denatured nucleic acid extracts from GVB-infected and several healthy muscadines. Hybridization signal was obtained from all four previously recognized GVB sources, with no visible reactions in spots containing extracts from negative controls. In this study, we demonstrated that muscadine can be naturally infected with GVB, a virus associated with grapevine corky bark (GCB) disease of the rugose wood complex (RW) that adversely affects Vitis vinifera (Martelli 2014). The impact of GVB infections in muscadine and its natural spread is yet to be studied. The coinfection of four samples of the same cultivar (despite their randomized position in the field) with the identical virus combination, along with the fact that they originated from the same nursery, strongly suggests virus dissemination with infected plant material, therefore calling for an increased awareness of possible negative consequences.

      References: