Skip main navigation
Close Drawer MenuOpen Drawer Menu
Previous
Next
RESEARCHFree Access icon

Characterizations of an Emerging Disease: Apple Blotch Caused by Diplocarpon coronariae (syn. Marssonina coronaria) in the Mid-Atlantic United States

    Affiliations
    Authors and Affiliations
    • Fatemeh Khodadadi1
    • Phillip L. Martin2
    • Daniel J. Donahue3
    • Kari A. Peter2
    • Srđan G. Aćimović1 †
    1. 1Virginia Polytechnic Institute and State University, School of Plant and Environmental Sciences, Alson H. Smith Jr. Agricultural Research and Extension Center, Winchester, VA
    2. 2Pennsylvania State University, Department of Plant Pathology and Environmental Microbiology, Fruit Research and Extension Center, Biglerville, PA
    3. 3Eastern New York Commercial Horticulture Program, Cornell Cooperative Extension, Cornell University, Highland, NY
    Published Online:15 Jun 2022https://doi.org/10.1094/PDIS-11-21-2557-RE

    Abstract

    Apple orchards with minimal or reduced fungicide inputs in the Mid-Atlantic region of the United States have experienced outbreaks of severe premature defoliation with symptoms that matched those of apple blotch disease (ABD) caused by Diplocarpon coronariae. Fungal isolates obtained from symptomatic apple leaves and fruit produced uniform slow-growing, dark-gray colonies on peptone potato dextrose agar and had conidia. Internal transcribed spacer DNA sequences matched with D. coronariae and Koch’s postulates were fulfilled when typical ABD symptoms occurred when reinoculated onto apple leaves and fruit. Spore dispersal in nonfungicide-treated orchards detected with quantitative PCR was low in early spring and dropped to undetectable levels in late May and early June before rising exponentially to highs in July and August, which coincided with symptom development. Only low spore numbers were detected in fungicide-treated orchards and nearby forests. In preliminary fungicide tests, fluxapyroxad, thiophanate methyl, and difenoconazole effectively inhibited mycelial growth of isolates in vitro. When apple cultivars Fuji and Honeycrisp were inoculated with D. coronariae, Honeycrisp showed delayed onset of symptoms and lower disease severity, and the transcription profile of seven host defense-related genes showed that PR-2, PR-8, LYK4, and CERK1 were highly induced in Honeycrisp at 2 and 5 days postinoculation. This is the first report of ABD in the Mid-Atlantic United States, which includes studies of seasonal D. coronariae spore dispersal patterns, preliminary fungicide efficacy, and host defense-related gene expression to assist development of best ABD management practices.

    Apple blotch disease (ABD) caused by Diplocarpon coronariae (Ellis & Davis) Wöhner & Rossman (Crous et al. 2020), formerly known as Marssonina leaf blotch caused by Marssonina coronaria (Ellis & Davis) Davis, teleomorph Diplocarpon mali (Y. Harada & Sawamura), is a devastating defoliating disease that affects leaves, fruit, and twigs of apple (Sagong et al. 2011; Sharma et al. 2004; Takahashi et al. 2014). The disease first presents itself as small circular, brown to black spots on the upper surface of mature leaves, where acervuli form and produce conidia (Sharma 2000; Wöhner and Emeriewen 2019). As the lesions grow, they induce a rapid yellowing or browning, depending on the cultivar, followed by severe crown defoliation, which reduces yield, affects fruit quality, and reduces the overall vigor of apple trees (Aćimović and Donahue 2018; Peter 2018; Sagong et al. 2011; Wöhner and Emeriewen 2019). Disease symptoms on apple fruit are rarely reported and appear as small, circular black lesions with acervuli at the center (Boutry et al. 2021; Takahashi et al. 2014).

    ABD has been reported in Wisconsin, United States (Davis 1903) and Canada (Parmelee 1971) but historically has not been a significant disease in North America. Takahashi et al. (2014) reported that, in Japan, ABD was the second most critical apple disease in the 1910s until Bordeaux mixture was introduced; however, it is again increasing in importance. ABD is a serious problem in China (Dong et al. 2015) and became a serious problem during the 1990s in India (Sharma 2000; Sharma and Gautam 1997) and Korea (Kim et al. 1998). It emerged in Europe in the early 2000s (Tamietti and Matta 2003) and, by the 2010s, had become a severe problem in the organic and conventional orchards with low chemical inputs (Hinrichs-Berger and Müller 2013; Wöhner and Emeriewen 2019). In the Mid-Atlantic United States, clear indicators and symptoms of ABD emerged in 2017, coinciding with severe defoliation on low- to nonfungicide-treated trees (Aćimović and Donahue 2018; Khodadadi et al. 2019; Peter 2018). We hypothesized the defoliation was from ABD caused by D. coronariae.

    Knowledge about the biology of D. coronariae and epidemiology of ABD is essential for integrated ABD management. D. coronariae is in the order Helotiales and family Drepanopezizaceae, which is a family that is often parasitic on leaves of various dicotyledons (Johnston et al. 2019). It is a hemibiotroph with latent periods of a few days to weeks (Wöhner and Emeriewen 2019; Zhao et al. 2013). The ABD disease cycle, as summarized by Wöhner and Emeriewen (2019), begins in the spring with the release of spores from overwintered leaves (and possibly from twigs and buds) during and after rainfall or periods of high humidity when temperatures are close to the optimum of 20 to 25°C. Spores land on leaves, germinate, form appressoria, penetrate the leaf cuticle, and form intracellular hyphae. The infections become necrotic and acervuli form on the leaf surface, producing secondary conidia. As the lesions grow, leaves become chlorotic and fall off the tree.

    The basics of the disease cycle are well known but the details of disease development and progression remain unclear. ABD symptoms have consistently first appeared in the summer around June to July in the northern hemisphere. The disease is polycyclic, with conidia from initial diseased leaves spreading ABD throughout the canopy. Extensive defoliation can occur in late summer and fall under warm, wet conditions (Takahashi et al. 2014). Although there is a consensus that peak spore dispersal coincides with peak symptom development and defoliation in July and August (Boutry et al. 2021; Dong et al. 2015; Goyal et al. 2018; Kim et al. 1998; Sastrahidayat and Nirwanto 2016), there is disagreement on the nature of the initial spores and the timing of spore dispersal. In Japan (Harada et al. 1974; Takahashi et al. 2014) and China (Dong et al. 2015), the initial spore dispersal in the spring is reported to be from ascospores whereas, in Korea (Kim et al. 2019), Indonesia (Sastrahidayat and Nirwanto 2016), and Europe (Boutry et al. 2021), only conidia have been observed. In India, Goyal et al. (2018) found only conidia, while Sharma and Gupta (2018) gave a first report of ascospores. Spore dispersal has been reported to begin with leaf development (Dong et al. 2015), just before bloom (Takahashi et al. 2014), and at fruit set (Goyal et al. 2018). Boutry et al. (2021) reported a small number of spores in March, with the primary initial dispersal in May after bloom. Knowing when spores are dispersed is essential for cultural control and timing of fungicide applications. Our objective was to determine the D. coronariae spore dispersal patterns in the Mid-Atlantic United States.

    Orchard sanitation and cultural practices accompanied by timely fungicide applications are recommended for ABD management (Aćimović and Donahue 2018; Dang et al. 2017). Fungicides are commonly used to successfully control ABD (Bohr et al. 2018; Dang et al. 2017; Thakur and Sharma 2010; Verma and Sharma 2003; Yin et al. 2013; Zhou et al. 2008), which is supported by our observation that ABD mostly appears in orchards with minimal to no fungicide coverage. However, multiple fungicides are usually applied in a rotation. We need data on which commonly used fungicides will provide ABD control in the Mid-Atlantic United States to guide fungicide selection and application rates and inform fungicide resistance management practices.

    The best long-term method to prevent this disease is to breed and plant tolerant apple cultivars (Chen et al. 2015; Dodds and Rathjen 2010; Duplessis et al. 2009; Yin et al. 2013). Apple breeding is a notoriously lengthy process. It can be greatly assisted by genomic tools, including the relative transcription levels of defense-related genes in apple cultivars when infected by D. coronariae (Li et al. 2012). Chitinases digest fungal cell walls during fungal infection and release chitin fragments, which trigger additional plant defense mechanisms (Boller 1995; Schlumbaum et al. 1986; Shibuya and Minami 2001). Two chitin receptors, a lysin motif receptor-like kinase (LYK4) and chitin-elicitor receptor kinase 1 (CERK1), play an important role in chitin signaling pathways (Cao et al. 2014; Miya et al. 2007; Wan et al. 2012; Yin et al. 2015). These receptors were significantly induced in apple in response to infection by Valsa mali (Yin et al. 2016). Cytochrome P450s (CYPs), a large family of about 630 genes in apple (Yin et al. 2016), can boost plant tolerance by synthesizing antimicrobial compounds such as phytoalexins and inhibiting the growth of pathogens (Ahuja et al. 2012; Glawischnig 2006; Hwang and Hwang 2010). Some CYP genes were upregulated in apple against infection by V. mali (Yin et al. 2016) and Podosphaera leucotricha (Tian et al. 2019). Pathogenesis-related (PR) proteins are another structurally large family of proteins that, upon pathogen attack, accumulate in different parts of plants (Sels et al. 2008). The induction of these infection-inhibiting proteins by D. coronariae and Erwinia amylovora was reported in apple (Bonasera et al. 2006; Li et al. 2014). We hypothesized that at least some of these apple genes are induced upon infection by D. coronariae.

    The objectives of this study in the Mid-Atlantic United States were (i) isolation, identification, characterization, and verification of pathogenicity of the ABD-causing fungal species; (ii) determination of seasonal spore dispersal patterns of D. coronariae; (iii) determination of efficacy of some commonly used fungicides at inhibiting D. coronariae growth using lab tests; and (iv) determination of transcription profiles of seven defense-related genes in the apple cultivars Fuji and Honeycrisp.

    Materials and Methods

    Plant material and collection of isolates.

    From 2017 to 2019, symptomatic apple fruit from cultivars Rome and Jonagold and leaves from Rome were collected from research and commercial orchards and storages in New York, Pennsylvania, and Virginia (Fig. 1). After disinfection of apple fruit with 5% bleach and rinsing with distilled water, a small piece at the edge of healthy and infected tissue was cut and transferred onto peptone potato dextrose agar (PPDA). Using a sterile needle under a microscope, conidia (asexual spores) were collected from the acervuli in the center of the leaf lesion and placed onto PPDA. The Petri plates were incubated at 25°C in dark for 3 to 4 weeks. Isolates were purified using the single-spore method (Choi et al. 1999) and maintained on PPDA for the subsequent assays.

    Fig. 1.

    Fig. 1. Typical symptoms of apple blotch disease on apple leaves and fruit. Development of symptoms on the surface of apple leaves of cultivars A, B, and D, Rome in Pennsylvania and C, Mutsu in New York. E and F, Round brown to black spots on Rome apple fruit in New York.

    Download as PowerPoint

    Effect of culture media on the growth of D. coronariae.

    We assessed the growth of a representative sample of 10 isolates on the following culture media: potato dextrose agar (PDA) (Difco, Detroit, MI, U.S.A.), Bacto-peptone (Gibco, Waltham, MA, U.S.A.) potato dextrose agar (PPDA), lima bean agar (Difco), corn meal agar (Difco), and malt extract agar (Difco). Water agar was used as a control. A 1-mm plug of 3-week-old D. coronariae colonies was transferred onto the solid media listed above, supplemented with streptomycin at 100 mg/ml and chloramphenicol at 20 mg/ml. Four replicate plates per each medium were incubated at 25°C in the dark for 3 weeks. The same experiment was conducted concurrently for incubation under light (T5HO fluorescent lamp, 6,400 K, 24 W; SunBlaster Horticultural Lighting, BC, Canada). Plates were photographed and the area of each colony (in square millimeters) was measured with the ImageJ 1.50i software (Schneider et al. 2012). Two-way analysis of variance (ANOVA) with Bonferroni post hoc test was performed to compare the efficiency of the growth media using GraphPad Prism version 5.00 for Windows OS (GraphPad Software, San Diego, CA, U.S.A.).

    DNA extraction, sequencing, and phylogenetic analysis.

    Genomic DNA was extracted from 3-week-old cultures of D. coronariae isolates using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA, U.S.A.). PCR was carried out to amplify the 570-bp fragment of the nuclear ribosomal DNA (rDNA) region containing the 5.8S rDNA and the two internal transcribed spacers (ITS) using primers ITS1 (5′-TCC GTA GGT GAA CCT GCG G-3′) and ITS4 (5′-TCC TCC GCT TAT TGA TAT GC-3′) (White et al. 1990). Reactions were carried out in 40-µl volumes and included 10× PCR buffer (Dream Taq; Thermo Fisher Scientific, Waltham, MA, U.S.A.), 50 ng of DNA template, 10 µM each primer, 1 mM the dNTPs, and one unit of Dream Taq DNA polymerase (Thermo Fisher Scientific). The PCR program consisted of an initial denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 1 min, annealing at 59°C for 30 s, extension at 72°C for 30 s; and a final extension step at 72°C for 7 min (Wöhner et al. 2019). The PCR products were checked for amplification with agarose (1% wt/vol) gel electrophoresis in 1× Tris-acetate-EDTA buffer at 94.1 V for 30 min. The purification of PCR products and Sanger sequencing for forward and reverse primers were performed by Eurofins Genomics LLC.

    Sequences from forward and reverse reads were assembled using Geneious (San Diego, CA, U.S.A.) (Kearse et al. 2012) or CodonCode Aligner software (Centerville, MA, U.S.A.) and deposited into NCBI GenBank under the accession numbers described in Table 1. ITS sequences were aligned with reference sequences of related taxa obtained from the NCBI database. Three Blumeriella spp. isolates were included as an outgroup because Blumeriella is a sister genus in the Drepanopezizaceae family (Johnston et al. 2019). Nine Drepanopeziza sequences were included because this is a closely related genus that historically has been placed in the genus Diplocarpon (syn. Marssonina). Reference sequences of D. coronariae were chosen to represent every geographical region from which ITS sequences are available, based on source information of the sequences in NCBI. Diseases caused by the referent species were obtained from published literature and used to provide a phytopathological context to the phylogeny.

    Table 1. Species designation, isolate culture identifier, host source and plant tissue, location of origin, and GenBank accession numbers of the sequences of Diplocarpon coronariae isolates generated in this study and Marssonina spp. retrieved from GenBank

    ITS sequences were aligned using ClustalW in MEGA software (Kumar et al. 2018). Alignments were manually viewed and trimmed. Because some of the reference sequences had base deletions and repeats indicative of low quality in the highly conserved 18S and 28S regions, the alignment was trimmed up to and including the 5′-GGATCATTAC-3′ motif at the end of 18S region and the 5′-GTTGACCTCG-3′ motif and downstream sequences at the beginning of 28S region.

    Phylogenetic analyses of the remaining ITS1, 5.8S, and ITS2 regions were conducted using maximum-parsimony (MP), maximum likelihood (ML), and Bayesian approaches. Total numbers of taxa and characters in the analysis were 98 and 540, respectively. MP was performed in PAUP software (Swofford 2003) using heuristic search, random stepwise addition, and all other settings to default, followed by a bootstrap analysis using “Fast” step-wise addition to 10,000 replicates.  ML analysis was conducted using RAxML-HPC2 (Stamatakis 2014) Workflow on XSEDE v8.2.12 in the CIPRES portal (Miller et al. 2010) with a majority-rule consensus tree was constructed using 1,000 bootstrap replicates and the GTRCAT model. Bayesian inference was conducted using MrBayes (Ronquist et al. 2012) on XSEDE v3.2.6 in the CIPRES portal implementing the BEAGLE library (Ayres et al. 2012). Posterior probabilities at branch nodes were inferred using two runs of 1,000,000 generations, with 25% burn-in. ML and MP bootstrap support values ≥ 70 and Bayesian probabilities ≥ 95 were placed onto the MP tree topology. 

    Pathogenicity.

    Pathogenicity was performed for 15 Diplocarpon isolates on the leaves of 4-month-old seedlings of Rome apple. The mycelial mass of 3-week-old cultures of D. coronariae isolates grown on PPDA was scraped off with a sterile scalpel and homogenized in 5 ml of sterile distilled water using a vortex mixer (Vanlab, Model K-550-G; Scientific Industries Inc, Bohemia, NY, U.S.A.). The concentration of suspension was adjusted to 1 × 106 conidia ml−1 and 0.01% Tween 20 was added. The inoculation was performed according to Wöhner et al. (2019), with slight modification as follows. Both sides of the leaves were sprayed entirely with the fungal suspension and each inoculated leaf was covered with a wet sterile paper towel and enclosed in clear plastic bags sprayed with distilled water to maintain humidity for 72 h under light in a growth chamber (Wöhner et al. 2019). Additionally, we chose the same 15 Diplocarpon isolates and examined their pathogenicity on apple fruit cultivar Mutsu. Apple fruit were sterilized with 70% ethanol and rinsed with sterile distilled water. Fruit were wounded with a sterile piercing tool and inoculated with 15 µl of Diplocarpon spore suspension (106 conidia ml−1) obtained from 3-week-old cultures. Inoculated fruit were kept in humid containers at 25°C for 3 weeks. Sterile distilled water was used to inoculate control apple fruit. Symptoms on leaves and fruit were closely monitored for 3 to 4 weeks. Our experimental design on leaves and fruit comprised three replicate plants per isolate (five leaves per plant) and five apple fruit per isolate (five inoculation points on each fruit), respectively.

    Spore trapping and quantification.

    The trapping of rain-splashed spores in orchards and forested woodlots and extraction of DNA from those spores was initially done for a study on Colletotrichum spp., where the methods are described in detail (Martin and Peter 2021) (P. L. Martin and K. A. Peter, unpublished). In summary, spores were trapped in standard fungicide- and nonfungicide-treated apple orchards and forested woodlots at the Penn State Fruit Research and Extension Center in Biglerville, PA. Two spore traps were placed in each orchard tree, one within the canopy or crown about 1 to 2 m above the ground and one about 50 cm above the ground. Spore traps in the forested woodlots were placed at least 50 m apart, 50 to 100 cm above the ground. Each year, 12 spore traps were placed in the apple orchard, with traps in and under three trees of Honeycrisp (two untreated and one treated with fungicides), one tree of Rome, and one tree of cultivar Delicious (both untreated), and one tree of cultivar Gala (treated with fungicides). The fungicide-treated trees did not receive fungicides after harvest in late August or early September. Two spore traps were placed in nearby forested woodlots, with one in a woodlot of primarily mature deciduous trees and one in a 20- to 30-year-old successional forest of deciduous trees. These forested areas consisted of shrubs, vines, and trees that were primarily a mixture of red maple (Acer rubrum), tulip popular (Liriodendron tulipifera), sassafras (Sassafras albidum), red oak (Quercus rubra), chestnut oak (Q. montana), black walnut (Juglans nigra), wild grape (Vitis spp.), amur honeysuckle (Lonicera maackii), poison ivy (Toxicodendron radicans), and hawthorn (Crataegus spp.), along with a few American beech (Fagus grandifolia), white oak (Q. alba), black willow (Salix nigra), black locust (Robinia pseudoacacia), quaking aspen (Populus tremuloides), mulberry (Morus spp.), black cherry (Prunus serotina), eastern white pine (Pinus strobus), autumn olive (Elaeagnus umbellata), and staghorn sumac (Rhus typhina). Additional spore traps from these forested areas and fungicide-treated orchards in Martin and Peter (2021) (P. L. Martin and K. A. Peter, unpublished) were not analyzed in this study because these locations had consistently low D. coronariae spore counts.

    Spore traps were constructed with Falcon 225-ml polypropylene conical centrifuge tubes (Corning Inc., Corning, NY, U.S.A.) and household-grade 13-cm plastic funnels to trap rainwater within and beneath the tree canopies. Spore trap samples were collected 12 times from May through October 2018, 19 times from April through November 2019, and 19 times from February through November 2020. Samples were collected within 36 h after a rain, the tubes were centrifuged with an Eppendorf 5810R centrifuge (Eppendorf North America, Hauppauge, NY, U.S.A.), and DNA was extracted using the NucleoSpin Soil DNA extraction kit (Macherey Nagel, Bethlehem, PA, U.S.A.), with modifications as described by Martin and Peter (2021).

    D. coronariae DNA was detected and quantified using a quantitative PCR (qPCR) method developed by Boutry et al. (2021). This is a TaqMan-based assay (Thermo Fisher Scientific) targeting the ITS1 region between 18S and 5.8S rDNA of D. coronariae using primers Dc_09_F (GCGTATACCACCCGTGCCTA) and Dc_09_R (CTCAGACATCACGTTATTCACACAA) and probe Dc_09_P (FAM-CCTACCTCTGTTGCTTTGGCGA-BHQ1) (Boutry et al. 2021). The reactions were run on a Bio-Rad C1000 thermocycler with the CFX96 detection system (Bio-Rad, Hercules, CA, U.S.A.). Each reaction included 10 µl of TaqMan Gene Expression Master Mix (2×), forward and reverse primers at final concentrations of 0.3 µM each, probes at a final concentration of 0.1 µM, 4 µl of template DNA, and nuclease-free water to bring the reaction total to 20 µl. All samples were run in triplicate. qPCR conditions were 50°C for 2 min and 95°C for 5 min, followed by 45 cycles of 95°C for 10 s and 60°C for 20 s.

    A DNA standard of an unknown quantity of D. coronariae DNA and 10-, 100-, and 1,000-fold dilutions of that standard were included in every qPCR run because we could not get a clean sample of D. coronariae conidia from our colonies growing in Petri dishes. Later, we obtained clean D. coronariae conidia from infected apple leaves and quantified three samples of D. coronariae conidia by averaging 20 hemocytometer counts of each sample. DNA was extracted from a calculated 5.6 × 106 conidia from each sample using the method described above, and these three samples of DNA from known quantities of D. coronariae conidia were used to convert the standard curve from arbitrary units to D. coronariae conidia. This corrected standard curve was used to convert the average cycle quantification (Cq) values of each sample to number of D. coronariae conidia per sample. The numbers of D. coronariae conidia per sample were calculated and graphed using Excel and the graphs were edited in PowerPoint (Microsoft, Redmond, WA, U.S.A.).

    Weather data and determination of infection pressure.

    Weather data were obtained from a Decagon EM50R data logger with Decagon VP-3 temperature and LWS leaf wetness sensors (Meter Group, Pullman, WA, U.S.A.) that had hourly data outputs of average temperature and minutes of leaf wetness (450-count threshold). The D. coronariae infection model of Lian et al. (2021) was used to predict the daily infection pressure. Daily average temperature and total hours of leaf wetness were calculated from the hourly data, and the daily infection pressure was calculated from the temperature and leaf wetness hours. The units of infection pressure for this model are presented as lesions per leaf but, because the model was based on growth chamber results and has not been field tested, it was interpreted as relative units of disease pressure. The daily disease pressure was graphed as a bar chart in the background of the spore-trapping graph using Excel.

    Fungicide sensitivity assays.

    Fungicide sensitivity of D. coronariae isolates was determined on PPDA supplemented with concentrations of the fungicides difenoconazole (Fungicide Resistance Action Committee [FRAC] group 3, Inspire 23.2% active ingredient [AI]; Syngenta Crop Protection, Research Triangle Park, Raleigh, NC) and thiophanate methyl (FRAC group 1, Topsin M 70% AI; United Phosphorus, King of Prussia, PA, U.S.A.) at 1, 0.1, 0.02, 0.01, 0.001 and 0.0001 µg/ml; and fluxapyroxad (FRAC group 7, Sercadis 26.55% AI; BASF Corporation, Research Triangle Park, NC, U.S.A.) at 1, 0.1, 0.01, 0.001 and 0.0001 µg/ml. In total, 41 isolates were evaluated for the fungicide sensitivity assay (Table 1). Fungicides were dissolved in acetone and water. Petri plates were incubated at 25°C in the dark for 3 weeks. Plates were photographed and the area of each colony was measured with ImageJ software (Schneider et al. 2012). To calculate the half maximal effective concentration (EC50) values, dose-response curves were fitted into a nonlinear regression analysis in GraphPad Prism version 5.00 for Windows OS (GraphPad Software, San Diego, CA, U.S.A.). Mean EC50 of each fungicide was performed using two-way ANOVA with a Bonferroni post hoc test using GraphPad Prism version 5.00 for Windows OS (GraphPad Software).

    Plant material, inoculation, and gene expression analysis.

    Healthy and uniform Honeycrisp and Fuji apple trees on rootstock G.41 were obtained from Wafler Nursery (Wolcott, NY, U.S.A.) and potted in 5-gal. pots using Potting Mix Miracle-Gro (OMS Investments Inc, Wilmington, DE, U.S.A.). The mycelial mass of a 3-week-old culture of D. coronariae strain ACR-14 from New York grown on PPDA was scraped off with a sterile scalpel and homogenized in 5 ml of sterile distilled water. The spore suspension (1 × 106 conidia ml−1) was prepared and trees were inoculated according to the methods of Wöhner et al. (2019), as described above in the pathogenicity section. Our experimental design comprised two cultivars and six replicate trees per each cultivar (nearly 40 leaves per each tree). Assessment of ABD severity was performed at 7, 10, 12, and 15 days postinoculation (dpi) with the Leaf Doctor app (Pethybridge and Nelson 2015) installed on a MacOS Big Sur. At each time point, individual leaves (six to seven replicates) from both cultivars were photographed against a black background. Symptoms were rated using the following severity scale: 0 = healthy leaves without any symptoms, 1 = dark to brown-colored spots <1 mm in size, 2 = necrotic lesions surrounded by yellow halo, 3 = leaves with expanded lesions and acervuli developed at the center of lesions and 4 = chlorotic leaf defoliation. However, to reduce the subjective errors in the rating scales, we presented data using percentages derived from the Leaf Doctor app. Subsequently, a multiple Student’s t test was performed to determine the statistical significance of two cultivars at each timepoint using GraphPad Prism version 5.00 for Windows OS (GraphPad Software).

    We used qPCR to assess the expression of chitin-related genes such as CERK1 and LYK4; PR genes such as class III endo-chitinase (PR-8) and β-1,3-glucanase (PR-2); and three CYP 450 genes with accession numbers 180684, 26412, and 184534. Total RNA was isolated from inoculated leaves harvested at 0, 2, 5, 8, and 12 dpi by the E.Z.N.A. Fungal RNA Mini Kit (Omega Bio-Tek, Norcross, GA, U.S.A.). The purity and quantity of the extracted RNA were measured with a Nanodrop ND-1000 Spectrophotometer (Thermo Fisher Scientific) and the integrity of RNA was certified by electrophoresis using a 1% agarose gel. Single-stranded cDNA was synthesized from 0.2 μg RNA of each sample, using random primers and a high-capacity cDNA reverse-transcription kit with RNase inhibitor (Thermo Fisher Scientific). The qPCR assays for seven primer pairs (Table 2) were performed in triplicate on cDNAs obtained from each biological replicate on a LightCycler 480 Instrument II with the 96-well block (Roche Holding AG, Basel, Switzerland) and Maxima SYBR Green Master Mix (2×) kit (Thermo Fisher Scientific). The elongation factor 1α gene (EF-1a) and actin gene from Malus were used as endogenous controls and reference genes for relative quantifications (Maxson-Stein et al. 2002; Yin et al. 2016). The cycling parameters of qPCR were set to 95°C for 10 min followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30s. Melting curves were obtained after 40 cycles by a denaturation step at 95°C for 5 s, followed by annealing at 65°C for 1 min and 97°C with a heating rate of 0.1°C/s and continuous fluorescence measurement. Final cooling was performed at 40°C for 30 s. Data were analyzed using the 2−ΔΔCt method (Livak and Schmittgen 2001) and statistical analyses were performed using one-way ANOVA with Tukey’s multiple comparison test using GraphPad Prism version 5.00 for Windows OS (GraphPad Software).

    Table 2. List of primers used in the gene expression using quantitative PCR

    Results

    Isolation, identification, and cultural conditions.

    In total, 54 isolates of D. coronariae were recovered; 12 from the black circular spots on the surface of apple fruit collected from New York and 42 from typical symptoms of ABD on apple leaves collected from Pennsylvania and Virginia (Table 1). Isolates were morphologically and molecularly characterized. The 5- to 9-mm dark-brown to black colonies without any aerial mycelia developed on PPDA after 3 to 4 weeks of incubation at 25°C in the dark (Fig. 2A). The two-celled spores ranged in length from 13 to 24 µm. The colony color, morphology, and conidial forms were consistent in appearance among all of the isolates (Fig. 2B).

    Fig. 2.

    Fig. 2. Cultural and morphological characteristics of Diplocarpon coronariae. A, Dark-brown to black colony of D. coronariae without aerial mycelia on peptone potato dextrose agar after 3 weeks at 25°C. B, Two-celled ampule-shaped spores under a light microscope (400×).

    Download as PowerPoint

    After 21 days of incubation on six different culture media colonized with a representative number of D. coronariae isolates at 25°C in the dark and light, statistical analyses indicated no significant difference between the area of growth in light and darkness (P < 0.05) (Fig. 3). D. coronariae developed a significantly greater area of colony growth on PDA and PPDA after 21 days under light conditions (Fig. 3). However, a significantly higher average colony size of 110 mm2 was obtained on PPDA under dark conditions compared with PDA (70 mm2) (Fig. 3). Overall, PPDA was the best medium to grow the colony of D. coronariae for the subsequent assays at 25°C in either darkness or light.

    Fig. 3.

    Fig. 3. Comparison of the mean area of colony (in square millimeters) of representative number of Diplocarpon coronariae isolates ACR14, ACR1, ACR8, ACR3, ACR13, PA27, BMO-9, Vtech-4, 5C-5, and PA3 grown on six different cultures after 21 days of incubation at 25°C under light and dark conditions. LBA = lima bean agar, CMA = corn meal agar, MEA = malt extract agar, PDA = potato dextrose agar, PPDA = peptone potato dextrose agar, and WA = water agar. Bars with a different letter differ significantly at P < 0.05 by Bonferroni’s multiple comparison test.

    Download as PowerPoint

    The ITS sequences of the isolates collected in this study were 100% identical to each other. A BLAST search on NCBI matched to 47 other sequences labeled as M. coronaria or D. coronariae with 96.96 to 100% similarity, while the next best match of 90.34% was to a different species. D. coronariae reference sequences on NCBI were from Argentina, India, South Korea, China, Japan, and Germany, of which the first three have been published in peer-reviewed papers (Fernandez et al. 2020; Lee et al. 2011; Phurailatpam et al. 2019). Bayesian, MP, and ML phylogenetic analyses strongly grouped the isolates identified in the literature as M. coronaria or D. coronariae into a well-supported clade within the Diplocarpon genus (Fig. 4). The isolates collected in this study fell within the D. coronariae clade with MP, ML, and Bayesian supports of 100, 91, and 1, respectively (Fig. 4). Therefore, all of the obtained isolates in this study were identified as D. coronariae (Fig. 4). The sequences of four New York isolates only had short, high-quality sections and were excluded from final phylogeny analyses; however, those sections showed 100% similarity with D. coronariae and these isolates were included in fungicide assay.

    Fig. 4.

    Fig. 4. Phylogenetic analysis of internal transcribed spacer sequences of the Diplocarpon coronariae isolates in this study (marked with asterisks) with reference isolates retrieved from NCBI, rooted with Blumeriella spp. isolates as the outgroup. Trees were constructed using maximum-parsimony (MP), maximum-likelihood (ML), and Bayesian inference analyses. MP and ML bootstrap support values ≥70 and Bayesian posterior probability values ≥0.95 are shown as MP, ML, and Bayesian and were placed at the nodes of one of the most parsimonious trees. Diseases caused by each species are listed where applicable.

    Download as PowerPoint

    Pathogenicity.

    All D. coronariae isolates were pathogenic on the leaves of apple seedlings. Symptoms appeared as minuscule brown to black spots at 10 dpi on the upper surface of leaves. The lesions grew to the size of blotches with frond-like edges and the ones greater than 3 mm were surrounded by a yellow halo, expanded, and were restricted between leaf veins. The development of black acervuli at the center of blotches was first detected at 22 dpi. Finally, massive chlorosis led to defoliation of infected leaves between 22 and 30 dpi (Fig. 5A to D). Unlike leaves that unanimously showed symptoms, only 67.3% of fruit inoculated with a representative number of isolates developed symptoms as small brown to black spots at the inoculation point (Fig. 5E to G). The isolates from Pennsylvania and Virginia which were predominantly obtained from symptomatic leaves were pathogenic on both apple leaves and fruit. Likewise, New York isolates collected from apple were pathogenic on both leaves and fruit. Typical D. coronariae colonies were recovered from all of the inoculated leaves and fruit to complete Koch’s postulates.

    Fig. 5.

    Fig. 5. Pathogenicity of Diplocarpon coronariae isolates on leaves and fruit of apple. Typical symptoms of apple blotch disease on Rome leaves at A and B, 10 days post inoculation (dpi); C, 17 dpi; and D, 28 dpi. E to G, Typical symptoms of apple blotch disease on fruit of cultivar Mutsu after 25 days of inoculation.

    Download as PowerPoint

    Detection and quantification of D. coronariae spores.

    Spore traps were collected from tree canopies of four cultivars (Honeycrisp, Rome, Gala, and Delicious) in three consecutive years from 2018 to 2020. In total, we collected and quantified 590 spore trap samples from 50 collection times (12 in 2018, 18 in 2019, and 19 in 2020). Samples from nonfungicide-treated orchards consistently showed higher conidia counts than samples from fungicide-treated trees and forested woodlots across 3 years (Fig. 6). The dramatic increase in spore counts in nonfungicide-treated orchards in the summer coincided with the typical visible ABD symptoms and leaf yellowing on mature leaves.

    Fig. 6.

    Fig. 6. Predicted apple blotch disease (ABD) infection pressure using the equations of Lian et al. (2021), which are functions of temperature (t) and leaf wetness hours (w), and quantitative PCR (qPCR) quantification of Diplocarpon coronariae spores trapped in and under the canopies of apple trees in fungicide- and nonfungicide-treated orchards and in nearby forests. The Lian et al. (2021) equations predict lesions per leaf but should be interpreted as relative indicators of disease pressure. Numbers of spores were calculated based on normalized cycle quantification values from qPCR using a standard curve with known amounts of spores. X-axis tick marks are on the first of each month. A, 2018 results; B, 2019 results; and C, 2020 results.

    Download as PowerPoint

    In 2018, conditions were hot and wet with correspondingly high predicted disease pressure; spore traps samples were collected from May to early October (Fig. 6A). In nonfungicide-treated orchards in 2018, no spores were detected until late June, with an exponential increase from early July to mid-August and a gradual decline to October (Fig. 6A). In fungicide-treated blocks, spore numbers were low until after harvest and, in the forest, spore numbers remained low throughout the season (Fig. 6A).

    In 2019, low spore numbers were detected in both nonfungicide- and fungicide-treated orchards in April at green tip and before bloom before dropping to undetectable levels in early May (Fig. 6B). At the very end of May, spores were detected in the nonfungicide-treated orchards. Spore numbers began an exponential increase that peaked in early July, followed by a gradual decline to October and an exponential decrease into November (Fig. 6B). The number of spores in fungicide-treated trees showed a rise about a month after harvest before dropping in November, while the spore numbers in forested areas were relatively low to nondetectable throughout the season (Fig. 6B).

    In 2020, we continued our spore trapping from November 2019, with collections from February to November 2020 to ensure that no early spore peak was missing. In nonfungicide-treated trees, spore numbers in February were nearly as high as they had been the previous November but declined to low numbers from mid-March through April (Fig. 6C). Spores were undetectable through May and early June, with an exponential increase in spore numbers from late June to early August, followed by a slightly less sharp but still exponential decrease through early November (Fig. 6C). Spore numbers in the fungicide-treated trees and the forests stayed relatively low throughout the season (Fig. 6C).

    Fungicide sensitivity.

    The in vitro screening to determine the EC50 of the fungicides thiophanate methyl, difenoconazole, and fluxapyroxad against D. coronariae showed that they suppressed the mycelial growth of D. coronariae isolates, with New York isolates showing more variability and significantly higher mean EC50 values (Fig. 7). Among isolates collected in New York, the mean EC50 for thiophanate methyl was significantly lower than for the other fungicides at P < 0.0001.

    Fig. 7.

    Fig. 7. Mean half maximal effective concentration (EC50) values of fungicides thiophanate methyl, difenoconazole, and fluxapyroxad against the colony growth of Diplocarpon coronariae isolates collected from New York, Pennsylvania, and Virginia. Different letters show the significance level at P < 0.0001 derived from Tukey’s multiple comparison test. Error bars indicate standard error of the mean.

    Download as PowerPoint

    Symptom development and gene expression patterns during apple–D. coronariae interactions.

    Following the inoculation of apple cultivars Fuji and Honeycrisp with D. coronariae isolate ACR-14, we visually monitored and recorded the initiation and presence of leaf symptoms about every 2 to 3 dpi up to 15 days. The first signs of infection occurred as small black lesions on the leaves of three biological replicates of Fuji at 6 to 7 dpi, indicating successful inoculation. By 10 dpi, symptoms were more spread on the leaf blade and developed on all inoculated leaves of Fuji. However, on Honeycrisp, the first symptoms were observed at 9 to 10 dpi and developed on a few other inoculated leaves in the next few days. On Honeycrisp, symptoms did not develop until after 9 to 10 dpi and showed lower disease severity than on Fuji. The first ABD defoliation was observed at 15 dpi for two leaves of one branch of one of the Fuji trees. A significant difference in disease severity was observed between the two cultivars at 7 dpi, with Fuji developing symptoms earlier than Honeycrisp (Fig. 8).

    Fig. 8.

    Fig. 8. Disease severity (%) of apple blotch symptoms on apple cultivars Fuji and Honeycrisp estimated by Leaf Doctor application at time intervals 5, 7, 8, 10, 12, and 15 days postinoculation (DPI). Severity values correspond to the mean of six leaf replicates per each cultivar.

    Download as PowerPoint

    We assessed the relative expression of seven resistance-related genes in leaves of Fuji and Honeycrisp infected with D. coronariae at five time points: 0, 2, 5, 8, and 12 dpi. Unlike actin, expression of EF-1a was more stable in treated and control leaf samples, especially at later time points such as 12 dpi for Fuji. Therefore, results are presented using EF-1a as the endogenous control. The specificity of the qPCR products was confirmed by the melting curve analysis. In ‘Honeycrisp’, PR-2, PR-8, and CERK1 showed significant induction at 2 and 5 dpi (P < 0.05). LYK4 was another chitin-related gene significantly expressed in Honeycrisp, with a normalized 3.5-fold change at 2 dpi compared with the control. Expression of cytochrome P450 was insignificant in Honeycrisp except for a slight increase in expression of cytochrome P450 (184534) at 12 dpi in comparison with the control (Fig. 9) while, in Fuji, PR genes (fold change > 15, P < 0.05) expression was significantly higher at 12 dpi in comparison with control. The transcript levels of CERK1 (8-fold) and two of the cytochrome P450s, 26412 (5-fold) and 184534 (15-fold), were also significant at 12 dpi (P < 0.05) (Fig. 9). Overall, the expression levels of defense-related PR and chitin genes were significantly higher in Honeycrisp than Fuji within the first 5 days of inoculation.

    Fig. 9.

    Fig. 9. Relative expression level change of seven selected genes for β-1,3-glucanase (pathogenesis-related [PR]-2), class III endo-chitinase (PR-8), chitin-elicitor receptor kinase 1 (CERK1), lysin motif receptor-like kinase 4 (LYK4), and three cytochrome P450 (CYP) genes (180684, 26412, and 184534) of apple in response to Diplocarpon coronariae infection at 0, 2, 5, 8, and 12 days postinoculation (DPI) using quantitative PCR. A, Fuji and B, Honeycrisp. Error bars indicate standard error of the mean for the average of six biological replicates. Different letters above the columns shows a significant difference and those with no letter are not significant when obtained by Tukey’s multiple comparison test (P < 0.05).

    Download as PowerPoint

    Discussion

    This study is the first report of ABD caused by D. coronariae in the Mid-Atlantic United States. We mostly observed ABD symptoms on apple leaves and recorded fruit infections only when disease pressure was high, which is consistent with reports from other areas (Boutry et al. 2021; Takahashi et al. 2014; Wöhner and Emeriewen 2019). The relatively low percentage of fruit that developed symptoms after inoculation is consistent with fruit being less susceptible than leaves. We have also observed ABD lesions on fruit that appeared after harvest in cold storage (data not shown).

    D. coronariae is a notoriously slow-growing fungus in culture, and determining the best culture media for colony growth yield will help in studying other pathological aspects of this pathogen. Our study indicates that D. coronariae grows faster on PPDA in the dark than on other media. Our results are directly in line with the findings that D. coronariae had a faster colony growth on PPDA than on PDA at 20°C and pH 6 (Lee et al. 2011), which indicates that the use of peptone as a supplement to PDA seems to stimulate colony growth of D. coronariae.

    In 2018, the first spore traps were set out in early May and the first spores were detected in late June, with exponential increases in nonfungicide-treated trees to the end of August. The exponential increase in the nonfungicide-treated trees was a few weeks later than the exponential increases in 2019 and 2020, even though May and June of 2018 had optimal conditions for ABD. We speculate that this was because D. coronariae was not yet fully established in our orchards, because the first time we had observed ABD symptoms was September 2017, and that, as D. coronariae inoculum built up in the orchard, symptoms kept presenting earlier in the summer until the fungus was fully established by 2019 and symptoms were first being observed by the end of June or early July. The emergence and rapid spread of ABD symptoms in June and July, especially under the warm, wet conditions that are common in Mid-Atlantic United States, is consistent with a large body of research from other regions (Boutry et al. 2021; Dong et al. 2015; Gao et al. 2011; Goyal et al. 2018; Harada et al. 1974; Kim et al. 1998; Sastrahidayat and Nirwanto 2016; Sharma et al. 2011; Takahashi et al. 2014).

    In 2019, spore trapping started in mid-April, and low spore numbers were detected in the two spore trapping times in April, which coincided with early pink bud and bloom growth stages; then, no spores were detected until the very end of May, when terminal shoot growth was about 15 cm. In 2020, spores were expectantly found in February, albeit in relatively low numbers, that declined to undetectable levels at the end of March. Low numbers were detected in April, which coincided with the green-tip to early-bloom growth stages; then, no spores were detected until mid-June. There are several ways these early-season spore counts could be interpreted. We speculate that the spores detected in February and early March were “spillover” from the buildup in the previous year and were washed off the branches and twigs by the rain. Although unexpectedly high, these numbers were still over three orders of magnitude lower than the numbers of the previous October. If this was the case, this complicates interpretation of the April spore counts because they, too, could have been from the previous year. However, given that the conditions were conducive for ABD over multiple days in April 2019 and several days in March and April 2020, it is also possible that the spores in April were released from acervuli or apothecia in leaf debris or the tree canopy. If these April spores infected young leaves, then May, when no spores could be detected, would have been a latent period until the infections turned necrotrophic and started producing secondary spores in June. This scenario of early-season spores causing the initial infections before or shortly after bloom would be consistent with Takahashi et al. (2014), who reported that, in Japan, ascospore dispersal begins just before bloom and usually lasts 3 to 4 weeks, with primary symptoms appearing in mid-June on mature leaves.

    We do not know whether our qPCR method was detecting ascospores or conidia. We did not observe any D. coronariae apothecia or asci throughout these experiments, although neither had we systematically sampled overwintered leaves, where they are reported to be most common. The description for ascospores overlaps with the description for conidia (Takahashi et al. 2014); thus, we could not discriminate between sexual or asexual reproduction based on spore shape alone.

    We did not observe any ABD symptoms on leaves during May, which would be the latent period if infections start in April, as indicated by Boutry et al. (2021). However, the early symptoms of ABD present as minute brown to purple spots that are nearly identical to early symptoms of Alternaria leaf blotch or frogeye leaf spot (Sutton et al. 2014). Alternaria leaf blotch and frogeye leaf spot are abundant in our nonfungicide-treated research plots and, thus, could have masked any early ABD symptoms.

    If May is a latent period for D. coronariae in the Mid-Atlantic United States, then this latent period is slightly longer than the 7 days indicated by Zhao et al. (2013) or the 7 to 30 days in other inoculation experiments (Goyal et al. 2018; Kumar and Sharma 2014; Lian et al. 2021; Yong et al. 2014). Although not the specific subject of any research that we are aware of, there are brief observations by Thakur and Sharma (2010) and Boutry et al. (2021) that younger leaves seem to be less susceptible to ABD or have longer latent periods than older leaves. This would explain the common observation that symptoms are first observed in June and July, even though there are often days with optimal infection conditions 1 to 2 months earlier in the season. It is also possible, considering that temperatures early in the season often drop below the optimal for ABD, that the length of the latent period is more related to temperature than to leaf age.

    The low spore number in forests indicates that D. coronariae has a strong host preference for Malus spp., consistent with Sastrahidayat and Nirwanto (2016). Our forested areas were only several hundred meters from apple orchards; therefore, it is possible that even the low spore number in the forest traps came from orchards. This would suggest that it is unlikely that the D. coronariae causing the ABD outbreak in the Mid-Atlantic United States originated from a wild source, or at least not from a non-Malus host.

    As to why ABD has been a problem in the past few years but not in the previous decades, we can only speculate. Possible reasons include a warmer, wetter climate and reduced fungicide usage made possible by apple scab-resistant cultivars (Oberhänsli et al. 2021). A third possibility, that a highly virulent strain of D. coronariae has arisen and has spread throughout apple-growing regions of the world, did not find support in the analysis of markers for simple sequence repeats by Oberhänsli et al. (2021), which grouped European, Asian, and North American D. coronariae into distinct groups. However, that study did find low genetic diversity of D. coronariae within Europe, consistent with a genetic bottleneck, and had small sample sizes from Asia and North America.

    The spore numbers in the fungicide-treated trees in 2018 had an exponential increase shortly after harvest and the cessation of fungicide applications, which was likely due to the exceptionally wet weather that would have washed off fungicide residues and created optimal conditions for ABD. Weather conditions were not as wet in 2019 and 2020 and increases in spore counts in the fungicide-treated trees did not occur until over a month after harvest and the cessation of fungicide applications. Overall, the low spore numbers in trees that received fungicides show that the current standard fungicide applications effectively control ABD.

    There are conflicting recommendations on the optimal timing of fungicides for ABD control. Takahashi et al. (2014) suggested that early sprays in May through June to prevent primary infection are important and effective in controlling outbreaks during summer. The field trials of Dang et al. (2017) suggested that the widely accepted practice by growers in Shaanxi, China of applying the first fungicides in May is unnecessary, and that postponing fungicide applications until shortly before typical symptom development in late June and early July provided equivalent or superior ABD control. Dang et al. (2017) noted that satisfactory ABD control was dependent on initiating fungicide applications before ABD incidence rose above 1%. We have not tested the effect of fungicide timing on ABD control but suggest that applying early-season fungicides will be beneficial if early infections occur in spring (Boutry et al. 2021). However, the rise in spore counts within only a few weeks after we stopped applying fungicides would indicate that early-season fungicides alone are insufficient for controlling ABD.

    There may be value in comparing ABD with apple scab, which is an example of an apple leaf disease where control of primary infections results in satisfactory season-long control (Penn State University Extension 2020). A key reason that apple scab can be controlled with fungicides timed to the primary infection period is that apple leaves become less susceptible to apple scab as they age (ontogenic resistance), which causes secondary apple scab infections to grow more slowly and produce fewer conidia than primary infections (Li and Xu 2002). In contrast, available evidence suggests that apple leaves are either equally susceptible to ABD throughout the season or possibly even increase in susceptibility to ABD as the season progresses. This would mean that, if any ABD infections become established, they could soon spread and reach epidemic levels unless kept in check by fungicide applications or nonconducive weather conditions. Because early-season fungicides are unlikely to eliminate D. coronariae, it would seem reasonable that fungicides are needed for satisfactory control whenever conditions are conducive for ABD (Dang et al. 2017; Kumar and Sharma 2014; Sharma and Verma 2005).

    D. coronariae is moderately to highly sensitive to a wide range of commercially available fungicides, of which FRAC groups 1, 3, 11, and M have been the most well-tested (Bala et al. 2001; Bohr et al. 2019; Dang et al. 2017; Kumar and Sharma 2014; Sharma and Verma 2005; Sharma et al. 2004; Tanaka et al. 2000; Thakur and Sharma 2010; Watpade et al. 2021; Zhao et al. 2009; Zhou et al. 2008). Because ABD tends to be well controlled by commercial fungicides, we only performed limited in vitro tests to determine which fungicides might be controlling ABD in the Mid-Atlantic United States.

    In our in vitro study, the fungicides difenoconazole, thiophanate-methyl, and fluxapyroxad effectively inhibited the colony growth of all D. coronariae isolates. These difenoconazole results are in line with those of Zhao et al. (2009), who found an EC50 of 0.009 µg/ml, but not with Dang et al. (2017), who reported EC50 values of 121.4 and 17.2 µg/ml for mycelial growth and spore germination, respectively. The results from Dang et al. (2017) were from a single isolate and were obtained by measuring the weight of mycelia in broth media, which could have produced different results than our solid-media-based assay. For thiophanate-methyl, Tanaka et al. (2000) from Japan reported a minimum inhibitory concentration (MIC) value for susceptible isolates of <0.19 µg/ml, which would be similar to our results, but also reported resistant isolates with MIC values of 100 and 200 µg/ml, whereas we did not find any resistant isolates. EC50 data among isolates collected in New York were spread over a wider range than those isolated from Virginia and Pennsylvania orchards, which could be due to the smaller number of tested isolates from New York.

    The ultimate test of fungicide efficacy is in field trials. Although our field trials are preliminary and ongoing, we note that good ABD control has been achieved in India and China with numerous fungicides and fungicide combinations from FRAC groups 3, 7, and 11 (Dang et al. 2017; Kumar and Sharma 2014; Thakur and Sharma 2010; Watpade et al. 2021; Zhao et al. 2009). In the Mid-Atlantic United States, captan and ziram are popular fungicides for summer cover sprays, where they are often mixed with Topsin (thiophanate-methyl) for extra sooty blotch and flyspeck control (Penn State University Extension 2020). Several reports out of India indicate that captan has fair to poor control of ABD (Bala et al. 2001; Sharma and Verma 2005; Sharma et al. 2004) whereas our preliminary field trials indicate it provides good control (data not shown). Thiophanate methyl shows excellent control with some curative properties (Kumar and Sharma 2014; Thakur and Sharma 2010) but overuse in Japan has led to resistance in D. coronariae (Tanaka et al. 2000). There are few reports on ziram efficacy but other fungicides in FRAC group M3 such as mancozeb, metiram, propineb, and zineb show excellent ABD control; thus, it is likely that ziram is also highly effective (Bala et al. 2001; Kumar and Sharma 2014; Sharma and Verma 2005; Sharma et al. 2004; Thakur and Sharma 2010; Watpade et al. 2021; Zhou et al. 2008). Based on their popularity and the low rates of ABD in orchards with regular fungicide applications, ziram, captan, and thiophanate-methyl likely provide much of the ABD control in commercial orchards in the Mid-Atlantic United States.

    Although fungicides are effective at controlling ABD, the best way to manage this disease would be with AND-resistant or AND-tolerant apple cultivars. The breeding of cultivars that have low susceptibility to ABD could be assisted with information on the genes and gene pathways involved in defense against D. coronariae infection. There is no information in the current literature showing the kinetic development of D. coronariae in apple with respect to the time point at which the pathogen triggers the defense receptors in the host. Therefore, we chose a wide range of time points after inoculation to better depict the transcriptional changes of defense-related genes in cultivars Fuji and Honeycrisp. PR and chitin-related genes were robustly induced in Honeycrisp at 2 and 5 dpi, indicating that these time points could be of importance for the pathogen to trigger the host transcriptional changes.

    Our data show that PR and chitin-related genes were expressed in apple following infection. Chitinase and β-1,3-glucanase proteins are reported to inhibit fungal growth through the lysis of hyphal tips, germ tubes, decomposing the fungal cell walls, and through activating a cascade of defense mechanisms induced by elicitors (Lawrence et al. 2000; Li et al. 2014; Mauch et al. 1988). We speculate that the high expression of these genes in the leaves of Honeycrisp apple might have strengthened the fungal cell wall or degraded the mycelia to the extent that led to a few days of delay in symptom appearance and lower disease severity in the early hours of infection, which is in line with what Li et al. (2014) found out about the induction of these genes in Malus domestica against Marssonina coronaria. Our findings are also consistent with several other studies. For instance, PR-2 and PR-8 were expressed in different tissues of apple against powdery mildew caused by Podosphaera leucotricha at 12, 24, and 48 h (Tian et al. 2019); fire blight bacterium Erwinia amylovora (Bonasera et al. 2006); and Botrytis cinerea infection and the yeast antagonist Candida oleophila (Liu et al. 2013). In our study, CERK1 (>100-fold) and LYK4 were significantly expressed in Honeycrisp, which concurred with the expression of these genes in apple against V. mali (Yin et al. 2016).

    Yin et al. (2016) reported 24 CYP P450 genes associated with secondary metabolite synthesis and defense in apple, of which we examined the expression of three CYP450 accessions (180684, 26412, and 184534). Both Fuji and Honeycrisp showed increased expression of CYP184534 and CYP26412 at 12 dpi, as compared with the control. These genes, along with 11 more, were significantly upregulated in the bark tissue of Fuji apple trees infected with V. mali 3 dpi (Yin et al. 2016). The cytochrome P450 is a superfamily consisting of a large group of genes (Hwang and Hwang 2010; Nelson 2006). Including more family members might provide a better picture of whether CYPs are expressed in apple against D. coronariae. Overall, our qPCR gene expression profiling showed that the seven genes we evaluated exhibited different expression patterns between Fuji and Honeycrisp, and that four of the genes were highly expressed in Honeycrisp within the first 5 days of inoculation.

    Apple cultivars do not differ significantly in susceptibility to ABD, according to Takahashi et al. (2014). However, Wöhner and Emeriewen (2019) have categorized apple cultivars as susceptible, intermediate, and resistant based on literature reviews. Interestingly, of the 29 cultivars ranked by Wöhner and Emeriewen (2019), 6 had conflicting rankings in the literature. These differences in reported susceptibility are likely due, in part, to differences in how the susceptibility was measured. For example, Yin et al. (2013) evaluated potted plants in a greenhouse 15 days after inoculation, while Li et al. (2012) evaluated orchard-grown trees under natural conditions. Because apple fruit are commercially grown in orchards, we believe that the best ABD susceptibility data comes from orchard data. We have not directly compared Fuji and Honeycrisp under orchard conditions but have observed defoliation in both cultivars by early fall if untreated. We further note that the ABD progression in our greenhouse trial differed by only a few days. With this in mind, we suggest that both cultivars should be considered susceptible to ABD from a commercial standpoint but that the disease progression in Honeycrisp in our study was slightly slower than in Fuji due to rapid and robust induction of defense genes under controlled conditions. These data inform our understanding of the D. coronariae–apple interaction, and these candidate defense-related genes might be used for the development of molecular methods to be utilized in a breeding program to facilitate the selection of resistant plants to control ABD.

    In summary, this is the first report of ABD caused by D. coronariae in the Mid-Atlantic United States. We show that D. coronariae spores are dispersed at very low levels in the spring, before an exponential rise in spore counts in mid- to late June that peaks in late July and early August, which coincides with symptom development. Only low numbers of spores are dispersed in orchards receiving fungicide treatments or in forested areas. We report that several fungicides commonly used in summer cover sprays in the Mid-Atlantic United States have good efficacy at controlling ABD in vitro. We further show that PR and chitin-related genes such as PR-2, PR-8, CERK1, and LYK4 are genes potentially involved in the interaction between apple and D. coronariae. These data will help to uncover the genetic mechanisms underlying the apple responses to D. coronariae. Overall, this study lays a foundation for the investigation of ABD in the United States and assists in developing and selecting the best ABD management practices.

    Acknowledgments

    We thank the apple growers of New York and Pennsylvania for supporting this work by providing disease samples and access to their farms and apple storages; and T. Krawczyk, B. Lehman, and K. Thomas at Pennsylvania State University for their technical support to K. A. Peter in evaluation of the Pennsylvania isolates.

    The author(s) declare no conflict of interest.

    Literature Cited

    • Aćimović, S. G., and Donahue, D. J. 2018. Marssonina leaf blotch of apple—A growing problem in South-Eastern New York. Tree Fruit News. 6:1-4. Google Scholar
    • Ahuja, I., Kissen, R., and Bones, A. M. 2012. Phytoalexins in defense against pathogens. Trends Plant Sci. 17:73-90. https://doi.org/10.1016/j.tplants.2011.11.002 Crossref, ISI, Google Scholar
    • Ayres, D. L., Darling, A., Zwickl, D. J., Beerli, P., Holder, M. T., Lewis, P. O., Huelsenbeck, J. P., Ronquist, F., Swofford, D. L., Cummings, M. P., Rambaut, A., and Suchard, M. A. 2012. BEAGLE: An application programming interface and high-performance computing library for statistical phylogenetics. Syst. Biol. 61:170-173. https://doi.org/10.1093/sysbio/syr100 Crossref, ISI, Google Scholar
    • Bala, R., Bhardwaj, L. N., Ram, V., and Sharma, G. K. 2001. Management of pre-mature leaf fall of apple. Plant Dis. Res. 16:119-122. Google Scholar
    • Bin, B., Zhao-Hui, W., Su-Qin, H., and Yan-Lin, G. 2019. Anthracnose of lettuce caused by Marssonina panattoniana in Gansu province. Microbiol. China. 46:2241-2248. Google Scholar
    • Bohr, A., Buchleither, S., Hechinger, M., and Mayr, U. 2018. Symptom occurrence and disease management of Marssonina blotch. Pages 36-42 in: Proc. 18th Int. Conf. Organic Fruit-Growing, 19-21 February 2018, Hohenheim, Germany, Foerdergemeinschaft Oekologischer Obstbau. Google Scholar
    • Bohr, A., Buchleither, S., and Mayr, U. 2019. Marsssonina coronaria—Fine tuning of direct regulation using acid clay. Pages 133-137 in: Ecofruit Proc. 2020. https://www.ecofruit.net/wp-content/uploads/2020/04/24_Bohr_133-137.pdf Google Scholar
    • Boller, T. 1995. Chemoperception of microbial signals in plant cells. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:189-214. https://doi.org/10.1146/annurev.pp.46.060195.001201 Crossref, ISI, Google Scholar
    • Bonasera, J. M., Kim, J. F., and Beer, S. V. 2006. PR genes of apple: Identification and expression in response to elicitors and inoculation with Erwinia amylovora. BMC Plant Biol. 6:23. https://doi.org/10.1186/1471-2229-6-23 Crossref, ISI, Google Scholar
    • Boutry, C., Bohr, A., Buchleither, S., Ludwig, M., Oberhänsli, T., Tamm, L., Schärer, H.-J., and Flury, P. 2021. Monitoring spore dispersal and early infections of Diplocarpon coronariae causing apple blotch using selected spore traps and a new qPCR method. bioRxiv. https://doi.org/10.1101/2021.07.25.453640 Google Scholar
    • Cao, Y., Liang, Y., Tanaka, K., Nguyen, C. T., Jedrzejczak, R. P., Joachimiak, A., and Stacey, G. 2014. The kinase LYK5 is a major chitin receptor in Arabidopsis and forms a chitin-induced complex with related kinase CERK1. eLife 3:e03766. https://doi.org/10.7554/eLife.03766 Crossref, ISI, Google Scholar
    • Chen, C., Yao, Y., Zhang, L., Xu, M., Jiang, J., Dou, T., Lin, W., Zhao, G., Huang, M., and Zhou, Y. 2015. A comprehensive analysis of the transcriptomes of Marssonina brunnea and infected poplar leaves to capture vital events in host-pathogen interactions. PLoS One 10:e0134246. https://doi.org/10.1371/journal.pone.0134246 ISI, Google Scholar
    • Choi, Y.-W., Hyde, K. D., and Ho, W. W. H. 1999. Single spore isolation of fungi. Fungal Divers. 3:29-38. Google Scholar
    • Crous, P. W., Wingfield, M. J., Schumacher, R. K., Akulov, A., Bulgakov, T. S., Carnegie, A. J., Jurjević, Ž., Decock, C., Denman, S., Lombard, L., Lawrence, D. P., Stack, A. J., Gordon, T. R., Bostock, R. M., Burgess, T., Summerell, B. A., Taylor, P. W. J., Edwards, J., Hou, L. W., Cai, L., Rossman, A. Y., Wöhner, T., Allen, W. C., Castlebury, L. A., Visagie, C. M., and Groenewald, J. Z. 2020. New and interesting fungi. 3. Fungal Syst. Evol. 6:157-231. https://doi.org/10.3114/fuse.2020.06.09 Crossref, Google Scholar
    • Dang, J. L., Gleason, M. L., Niu, C. K., Liu, X., Guo, Y. Z., Zhang, R., and Sun, G. Y. 2017. Effects of fungicides and spray application interval on controlling Marssonina blotch of apple in the Loess Plateau Region of China. Plant Dis. 101:568-575. https://doi.org/10.1094/PDIS-04-16-0464-RE Link, ISI, Google Scholar
    • Davis, J. J. 1903. Third supplementary list of parasitic fungi of Wisconsin. Trans. Wisc. Acad. Sci. Arts Lett. 14:83-106. Google Scholar
    • Dodds, P. N., and Rathjen, J. P. 2010. Plant immunity: Towards an integrated view of plant-pathogen interactions. Nat. Rev. Genet. 11:539-548. https://doi.org/10.1038/nrg2812 Crossref, ISI, Google Scholar
    • Dong, X., Gao, Y. E., Li, B. H., Yong, D. J., Wang, C. X., Li, G. F., and Li, B. D. 2015. Epidemic dynamics of apple Marssonina leaf blotch over whole growth season in the central area of Shandong Peninsula. Sci. Agric. Sin. 48:479-487. Crossref, Google Scholar
    • Duplessis, S., Major, I., Martin, F., and Séguin, A. 2009. Poplar and pathogen interactions: Insights from Populus genome-wide analyses of resistance and defense gene families and gene expression profiling. CRC. Crit. Rev. Plant Sci. 28:309-334. https://doi.org/10.1080/07352680903241063 Crossref, ISI, Google Scholar
    • Fernandez, L., Berutti, G., Gariglio, N., Favaro, M. A., and Maumary, R. 2020. Marssonina coronaria, new causal agent of leaf spots in apple trees with low chilling requirements in central Argentina. Cienc. Agrar. 19:43-53. Google Scholar
    • Gao, Y.-e., Li, B.-h., Dong, X.-l., Wang, C.-x., Li, G.-f., and Li, B.-d. 2011. Effects of temperature and moisture on sporulation of Diplocarpon mali on overwintered apple leaves. Sci. Agric. Sin. 44:1367-1374. Google Scholar
    • Glawischnig, E. 2006. The role of cytochrome P450 enzymes in the biosynthesis of camalexin. Biochem. Soc. Trans. 34:1206-1208. https://doi.org/10.1042/BST0341206 Crossref, ISI, Google Scholar
    • Goyal, A., Sharma, J. N., and Phurailatpam, S. 2018. Studies on the mode of survival of Diplocarpon mali causing premature leaf fall of apple. Int. J. Curr. Microbiol. Appl. Sci. 7:2465-2474. https://doi.org/10.20546/ijcmas.2018.708.249 Crossref, Google Scholar
    • Harada, Y., Sawamura, K., and Konno, K. 1974. Diplocarpon mali, sp. nov., the perfect state of apple blotch fungus Marssonina coronaria. Jpn. J. Phytopathol. 40:412-418. https://doi.org/10.3186/jjphytopath.40.412 Crossref, Google Scholar
    • Hinrichs-Berger, J., and Müller, G. 2013. Zum Auftreten von Marssonina coronaria an Apfel in Baden-Württemberg [Occurrence of Marssonina coronaria on apple in Baden-Wuerttemberg]. J. Kulturpflanz. 65:347-350. https://doi.org/10.5073/JFK.2013.09.02 Google Scholar
    • Hwang, I. S., and Hwang, B. K. 2010. Role of the pepper cytochrome P450 gene cacyp450a in defense responses against microbial pathogens. Planta 232:1409-1421. https://doi.org/10.1007/s00425-010-1266-y Crossref, ISI, Google Scholar
    • Johnston, P. R., Quijada, L., Smith, C. A., Baral, H.-O., Hosoya, T., Baschien, C., Pärtel, K., Zhuang, W.-Y., Haelewaters, D., Park, D., Carl, S., López-Giráldez, F., Wang, Z., and Townsend, J. P. 2019. A multigene phylogeny toward a new phylogenetic classification of Leotiomycetes. IMA Fungus 10:1. https://doi.org/10.1186/s43008-019-0002-x Crossref, ISI, Google Scholar
    • Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647-1649. Crossref, ISI, Google Scholar
    • Khodadadi, F., Peter, K., Donahue, D., and Aćimović, S. 2019. Marssonina blotch of apple caused by Marssonina coronaria in New York. (Abstr.) Phytopathology 109:S2.114. ISI, Google Scholar
    • Kim, D.-A., Lee, S.-W., and Lee, J.-T. 1998. Ecology of Marssonina blotch caused by Diplocarpon mali on apple tree in Kyungpook, Korea. Curr. Res. Agric. Life Sci. 16:84-95. Google Scholar
    • Kim, H., Jo, J., Kang, W. S., Do, Y. S., Lee, D. H., Ahn, M., Park, J. H., and Park, E. W. 2019. MBCAST : A forecast model for Marssonina blotch of apple in Korea. Plant Pathol. J. 35:585-597. https://doi.org/10.5423/PPJ.OA.09.2019.0236 Crossref, ISI, Google Scholar
    • Kumar, A., and Sharma, J. N. 2014. Monitored control of Marssonina blotch of apple caused by Marssonina coronaria. Indian Phytopathol. 67:70-76. Google Scholar
    • Kumar, S., Stecher, G., Li, M., Knyaz, C., and Tamura, K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35:1547-1549. https://doi.org/10.1093/molbev/msy096 Crossref, ISI, Google Scholar
    • Lawrence, C. B., Singh, N. P., Qiu, J., Gardner, R. G., and Tuzun, S. 2000. Constitutive hydrolytic enzymes are associated with polygenic resistance of tomato to Alternaria solani and may function as an elicitor release mechanism. Physiol. Mol. Plant. 57:211-220. Crossref, ISI, Google Scholar
    • Lee, D.-H., Back, C.-G., Win, N. K. K., Choi, K.-H., Kim, K.-M., Kang, I.-K., Choi, C., Yoon, T.-M., Uhm, J. Y., and Jung, H.-Y. 2011. Biological characterization of Marssonina coronaria associated with apple blotch disease. Mycobiology 39:200-205. https://doi.org/10.5941/MYCO.2011.39.3.200 Crossref, Google Scholar
    • Li, B., and Xu, X. 2002. Infection and development of apple scab (Venturia inaequalis) on old leaves. J. Phytopathol. 150:687-691. https://doi.org/10.1046/j.1439-0434.2002.00824.x Crossref, ISI, Google Scholar
    • Li, M., Xu, J., Qiu, Z., Zhang, J., Ma, F., and Zhang, J. 2014. Screening and identification of resistance related proteins from apple leaves inoculated with Marssonina coronaria (Ell. & J. J. Davis). Proteome Sci. 12:7. https://doi.org/10.1186/1477-5956-12-7 Crossref, ISI, Google Scholar
    • Li, Y., Hirst, P. M., Wan, Y., Liu, Y., Zhou, Q., Gao, H., Guo, Y., Zhao, Z., Wang, L., and Hu, M. 2012. Resistance to Marssonina coronaria and Alternaria alternata apple pathotype in the major apple cultivars and rootstocks used in China. HortScience 47:1241-1244. https://doi.org/10.21273/HORTSCI.47.9.1241 Crossref, ISI, Google Scholar
    • Lian, S., Dong, X. L., Li, P. L., Wang, C. X., Zhou, S. Y., and Li, B. H. 2021. Effects of temperature and moisture on conidia germination, infection, and acervulus formation of the apple Marssonina leaf blotch pathogen (Diplocarpon mali) in China. Plant Dis. 105:1057-1064. https://doi.org/10.1094/PDIS-06-20-1180-RE Link, ISI, Google Scholar
    • Liu, J., Wisniewski, M., Artlip, T., Sui, Y., Droby, S., and Norelli, J. 2013. The potential role of PR-8 gene of apple fruit in the mode of action of the yeast antagonist, Candida oleophila, in postharvest biocontrol of Botrytis cinerea. Postharvest Biol. Technol. 85:203-209. Crossref, ISI, Google Scholar
    • Livak, K. J., and Schmittgen, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25:402-408. https://doi.org/10.1006/meth.2001.1262 Crossref, ISI, Google Scholar
    • Martin, P. L., and Peter, K. A. 2021. Quantification of Colletotrichum fioriniae in orchards and deciduous forests indicates it is primarily a leaf endophyte. Phytopathology 111:333-344. https://doi.org/10.1094/PHYTO-05-20-0157-R Link, ISI, Google Scholar
    • Mauch, F., Hadwiger, L. A., and Boller, T. 1988. Antifungal hydrolases in pea tissue. Purification and characterization of two chitinases and two β-1,3-glucanases differentially regulated during development and in response to fungal infection. Plant Physiol. 87:325-333. Crossref, ISI, Google Scholar
    • Maxson-Stein, K., He, S. Y., Hammerschmidt, R., and Jones, A. L. 2002. Effect of treating apple trees with acibenzolar-S-methyl on fire blight and expression of pathogenesis-related protein genes. Plant Dis. 86:785-790. https://doi.org/10.1094/PDIS.2002.86.7.785 Link, ISI, Google Scholar
    • Miller, M. A., Pfeiffer, W., and Schwartz, T. 2010. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Pages 1-8 in: Proc. Gateway Comput. Environ. Workshop (GCE), New Orleans, LA, U.S.A. https://doi.org/10.1109/GCE.2010.5676129 Google Scholar
    • Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka, Y., Kawakami, N., Kaku, H., and Shibuya, N. 2007. CERK1, a LysM receptor kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104:19613-19618. https://doi.org/10.1073/pnas.0705147104 Crossref, ISI, Google Scholar
    • Nelson, D. R. 2006. Cytochrome P450 nomenclature, 2004. Pages 1-10 in: Cytochrome P450 Protocols, 2nd ed. I. R. Phillips and E. A. Shephard, eds. Methods in Molecular Biology, vol. 320. Humana Press, Totowa, NJ, U.S.A. Google Scholar
    • Oberhänsli, T., Dalbosco, A., Leschenne, V., Bohr, A., Buchleither, S., Tamm, L., Wille, L., Aćimović, S. G., Khodadadi, F., Ryu, Y.-H., Studer, B., Schärer, H.-J., and Patocchi, A. 2021. Multiplexed SSR marker analysis of Diplocarpon coronariae reveals clonality within samples from Middle Europe and genetic distance from Asian and North American isolates. CABI Agric. Biosci. 2:21. https://doi.org/10.1186/s43170-021-00039-6 Crossref, Google Scholar
    • Parmelee, J. A. 1971. Marssonina leafspot of Apple. Can. Plant Dis. Surv. 51:91-92. Google Scholar
    • Penn State University Extension. 2020. 2020-2021 Penn State Tree Fruit Production Guide. R. Crassweller, ed. Penn State University, University Park, PA, U.S.A. Google Scholar
    • Peter, K. A. 2018. Apple Disease - Marssonina Blotch. Penn State Extension. https://extension.psu.edu/apple-disease-marssonina-blotch Google Scholar
    • Pethybridge, S. J., and Nelson, S. C. 2015. Leaf doctor: A new portable application for quantifying plant disease severity. Plant Dis. 99:1310-1316. https://doi.org/10.1094/PDIS-03-15-0319-RE Link, ISI, Google Scholar
    • Phurailatpam, S., Sharma, J. N., Brakta, A., Sharma, S., and Sharma, S. 2019. Morphological and molecular characterization of Marssonina coronaria (Ellis & J. J. Davis) J. J. Davis causing premature leaf fall. Int. J. Curr. Microbiol. Appl. Sci. 8:2762-2769. https://doi.org/10.20546/ijcmas.2019.806.333 Crossref, Google Scholar
    • Robinson, R. J., Könyves, K., and Scrace, J. 2017. First record of the fungus Blumeriella kerriae in the UK. New Dis. Rep. 35:34. https://doi.org/10.5197/j.2044-0588.2017.035.034 Crossref, Google Scholar
    • Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L., Darling, A., Höhna, S., Larget, B., Liu, L., Suchard, M. A., and Huelsenbeck, J. P. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61:539-542. https://doi.org/10.1093/sysbio/sys029 Crossref, ISI, Google Scholar
    • Sagong, D.-H., Kweon, H.-J., Song, Y.-Y., Park, M.-Y., Nam, J.-C., Kang, S.-B., and Lee, S.-G. 2011. Influence of defoliation by Marssonina blotch on vegetative growth and fruit quality in ’Fuji’/M. 9 apple tree. Hortic. Sci. Technol. 29:531-538. ISI, Google Scholar
    • Sastrahidayat, I. R., and Nirwanto, H. 2016. Marssonina leaf blotch on the apple orchard in batu, Indonesia. Agrivita J. Agric. Sci. 38:204-212. https://doi.org/10.17503/agrivita.v38i2.635 Crossref, ISI, Google Scholar
    • Schlumbaum, A., Mauch, F., Vögeli, U., and Boller, T. 1986. Plant chitinases are potent inhibitors of fungal growth. Nature 324:365-367. https://doi.org/10.1038/324365a0 Crossref, ISI, Google Scholar
    • Schneider, C. A., Rasband, W. S., and Eliceiri, K. W. 2012. NIH Image to ImageJ: 25 Years of image analysis. Nat. Methods 9:671-675. https://doi.org/10.1038/nmeth.2089 Crossref, ISI, Google Scholar
    • Sels, J., Mathys, J., De Coninck, B. M. A., Cammue, B. P. A., and De Bolle, M. F. C. 2008. Plant pathogenesis-related (PR) proteins: A focus on PR peptides. Plant Physiol. Biochem. 46:941-950. https://doi.org/10.1016/j.plaphy.2008.06.011 Crossref, ISI, Google Scholar
    • Sharma, J. N. 2000. Marssonina blotch—A new disease of apple and its control. Indian J. Plant Prot. 28:100-101. Google Scholar
    • Sharma, J. N., and Gautam, D. R. 1997. Studies on premature leaf fall in apple—A new problem. Indian J. Plant Prot. 25:8-12. Google Scholar
    • Sharma, J. N., Sharma, A., and Sharma, P. 2004. Out-break of Marssonina blotch in warmer climates causing premature leaf fall problem of apple and its management. Acta Hortic. 662:405-409. https://doi.org/10.17660/ActaHortic.2004.662.61 Crossref, Google Scholar
    • Sharma, J. N., and Verma, K. D. 2005. Integrated management of foliar and fruit diseases of apple in Himachal Pradesh. J. Mycol. Plant Pathol. 35:48-52. Google Scholar
    • Sharma, N., Thakur, V. S., Sharma, S. K., Mohan, J., and Khurana, S. M. P. 2011. Development of Marssonina blotch (Marssonina coronaria) in different genotypes of apple. Indian Phytopathol. 64:358-362. Google Scholar
    • Sharma, U., and Gupta, B. 2018. First report of Diplocarpon mali, the perfect state of apple blotch fungus Marssonina coronaria from India. J. Krishi Vigyan 7:239. https://doi.org/10.5958/2349-4433.2018.00144.7 Crossref, Google Scholar
    • Shibuya, N., and Minami, E. 2001. Oligosaccharide signalling for defence responses in plant. Physiol. Mol. Plant Pathol. 59:223-233. https://doi.org/10.1006/pmpp.2001.0364 Crossref, ISI, Google Scholar
    • Stamatakis, A. 2014. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312-1313. https://doi.org/10.1093/bioinformatics/btu033 Crossref, ISI, Google Scholar
    • Sutton, T. B., Aldwinckle, H. S., Agnello, A. M., and Walgenbach, J. F., eds. 2014. Compendium of Apple and Pear Diseases and Pests. American Phytopathological Society, St. Paul, MN, U.S.A. Google Scholar
    • Swofford, D. L. 2003. PAUP*4.0: Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates, Sunderland, MA, U.S.A. Google Scholar
    • Takahashi, S., Sawamura, K., and Sato, Y. 2014. Marssonina Blotch. Pages 46-47 in: Compendium of Apple and Pear Diseases and Pests. T. B. Sutton, H. S. Aldwinckle, A. M. Agnello, and J. F. Walgenbach, eds. American Phytopathological Society, St. Paul, MN, U.S.A. Google Scholar
    • Tamietti, G., and Matta, A. 2003. First report of leaf blotch caused by Marssonina coronaria on apple in Italy. Plant Dis. 87:1005. https://doi.org/10.1094/PDIS.2003.87.8.1005B Link, ISI, Google Scholar
    • Tanaka, S., Kamegawa, N., Itol, S.-i., and Kameya-Iwaki, M. 2000. Detection of thiophanate-methyl-resistant strains in Diplocarpon mali, causal fungus of apple blotch. J. Gen. Plant Pathol. 85:82-85. https://doi.org/10.1007/PL00012926 Crossref, Google Scholar
    • Thakur, V. S., and Sharma, N. 2010. Epidemic outbreak of apple blotch disease: Epidemiology and management in Himachal Pradesh. Indian Phytopathol. 63:141-144. Google Scholar
    • Tian, X., Zhang, L., Feng, S., Zhao, Z., Wang, X., and Gao, H. 2019. Transcriptome analysis of apple leaves in response to powdery mildew (Podosphaera leucotricha) infection. Int. J. Mol. Sci. 20:2326. https://doi.org/10.3390/ijms20092326 Crossref, ISI, Google Scholar
    • Verma, K. D., and Sharma, J. N. 2003. Scab and Marssonina blotch—Threatening diseases of apple and their management. Annu. Rev. Plant Pathol. 2:207-220. Google Scholar
    • Vu, D., Groenewald, M., de Vries, M., Gehrmann, T., Stielow, B., Eberhardt, U., Al-Hatmi, A., Groenewald, J. Z., Cardinali, G., Houbraken, J., Boekhout, T., Crous, P. W., Robert, V., and Verkley, G. J. M. 2019. Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation. Stud. Mycol. 92:135-154. https://doi.org/10.1016/j.simyco.2018.05.001 Crossref, ISI, Google Scholar
    • Wan, J., Tanaka, K., Zhang, X. C., Son, G. H., Brechenmacher, L., Nguyen, T. H. N., and Stacey, G. 2012. LYK4, a lysin motif receptor-like kinase, is important for chitin signaling and plant innate immunity in Arabidopsis. Plant Physiol. 160:396-406. https://doi.org/10.1104/pp.112.201699 Crossref, ISI, Google Scholar
    • Watpade, S., Kumar, R., Pramanick, K. K., Shukla, A. K., Kumar, J., Mhatre, P. H., and Sharma, U. 2021. Management of premature leaf fall (Marssonina coronaria) of apple with new generation fungicides in the North-Western Himalayan Region of India. J. Phytopathol. 169:724-732. https://doi.org/10.1111/jph.13044 Crossref, ISI, Google Scholar
    • White, T. J., Bruns, S., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. H. White, eds. Academic Press, San Diego, CA, U.S.A. https://doi.org/10.1016/B978-0-12-372180-8.50042-1 Crossref, Google Scholar
    • Wöhner, T., and Emeriewen, O. F. 2019. Apple blotch disease (Marssonina coronaria (Ellis & Davis) Davis)—Review and research prospects. Eur. J. Plant Pathol. 153:657-669. https://doi.org/10.1007/s10658-018-1590-9 Crossref, ISI, Google Scholar
    • Wöhner, T., Girichev, V., Radatz, S., Lauria-Baca, B., Scheinpflug, H., and Hanke, M.-V. 2019. Evaluation of Malus gene bank resources with German strains of Marssonina coronaria using a greenhouse-based screening method. Eur. J. Plant Pathol. 153:743-757. https://doi.org/10.1007/s10658-018-1588-3 Crossref, ISI, Google Scholar
    • Yin, L., Li, M., Ke, X., Li, C., Zou, Y., Liang, D., and Ma, F. 2013. Evaluation of Malus germplasm resistance to Marssonina apple blotch. Eur. J. Plant Pathol. 136:597-602. https://doi.org/10.1007/s10658-013-0190-y Crossref, ISI, Google Scholar
    • Yin, Z., Ke, X., Kang, Z., and Huang, L. 2016. Apple resistance responses against Valsa mali revealed by transcriptomics analyses. Physiol. Mol. Plant Pathol. 93:85-92. https://doi.org/10.1016/j.pmpp.2016.01.004 Crossref, ISI, Google Scholar
    • Yin, Z., Liu, H., Li, Z., Ke, X., Dou, D., Gao, X., Song, N., Dai, Q., Wu, Y., Xu, J.-R., Kang, Z., and Huang, L. 2015. Genome sequence of Valsa canker pathogens uncovers a potential adaptation of colonization of woody bark. New Phytol. 208:1202-1216. https://doi.org/10.1111/nph.13544 Crossref, ISI, Google Scholar
    • Yong, D., Li, B., Zhang, Y., Wang, C., Dong, X., and Guo, C. 2014. Temporal incubation dynamic of apple leaf brown spot caused by Diplocarpon mali. Sci. Agric. Sin. 47:3103-3111. Google Scholar
    • Zhao, H., Han, Q., Wang, J., Gao, X., Xiao, C. L., Liu, J., and Huang, L. 2013. Cytology of infection of apple leaves by Diplocarpon mali. Eur. J. Plant Pathol. 136:41-49. https://doi.org/10.1007/s10658-012-0129-8 Crossref, ISI, Google Scholar
    • Zhao, H., Zhou, T., Cheng, J., Li, X., and Huang, L. 2009. Control effect of triazole fungicides in controlling Marssonina coronaria in vitro and in field. Sci. Silvae Sin. 45:68-73. Google Scholar
    • Zhou, T., Zhao, H., Huang, L., Xi, H., Zhou, D., and Cheng, J. 2008. Efficacy of propineb for controlling leaf blotch caused by Marssonina coronaria and its effect on zinc content in apple leaves. Acta Phytophylac. Sin. 35:519-524. Google Scholar
    • Zhu, S., Cao, Y.-Z., Jiang, C., Tan, B.-Y., Wang, Z., Feng, S., Zhang, L., Su, X.-H., Brejova, B., Vinar, T., Xu, M., Wang, M.-X., Zhang, S.-G., Huang, M.-R., Wu, R., and Zhou, Y. 2012. Sequencing the genome of Marssonina brunnea reveals fungus-poplar co-evolution. BMC Genomics 13:382. https://doi.org/10.1186/1471-2164-13-382 Crossref, ISI, Google Scholar

    F. Khodadadi and P. L. Martin contributed equally to this work.

    Current address of P. L. Martin: LABServices Inc., Hamburg, PA

    Funding: This material is based upon work supported by the Cornell Cooperative Extension’s Eastern New York Commercial Horticulture Program through a Challenge Fund Grant project number 10139 titled “Confirm the Presence and Distribution of a New Apple Disease in Eastern New York” to S. G. Aćimović and D. J. Dohahue, complimented by unrestricted research program funds of S. G. Aćimović. This work was also supported by the United States Department of Agriculture–National Institute of Food and Agriculture and Federal Appropriations under Project PENO004694 (accession 1018736) and the State Horticultural Association of Pennsylvania for K. A. Peter.

    The author(s) declare no conflict of interest.