Faba Bean Gall Pathogen Physoderma viciae: New Primers Reveal Its Puzzling Association with the Field Pea Ascochyta Complex

In Ethiopia, faba bean is the most important pulse crop, grown on 0.49 M ha (Central Statistical Agency of Ethiopia 2019). However, in 2010, Faba Bean Gall (FBG) disease was reported causing galling and distortion of faba bean foliage in the North Shoa region, subsequently spreading rapidly and becoming increasingly severe (Abebe et al. 2014; Bitew 2015; Debela et al. 2017; Hailemariam et al. 2016; Hailu et al. 2014). Debela et al. (2017) highlighted up to 100% losses from FBG, and as particularly occur across the higher altitudes of 2,000 to 4,000 m above sea level (a.s.l.) where rainfall is greatest (Abebe et al. 2014; Bitew and Kebede 2012). Not only did FBG quickly become established across all main faba bean growing regions of Ethiopia but did so at severities surpassing all other diseases (Hailu et al. 2014).

Recent morphological and molecular studies by You et al. (2021) confirmed Physoderma viciae, and not Olpidium viciae, as the causal agent for the devastating FBG disease on faba bean (Vicia faba) in Ethiopia and also highlighted its ability to cross-infect other host genera such as Pisum and Trifolium. This diversity in host range underlines an increased biosecurity hazard for countries that currently remain free from FBG (You et al. 2021).

One of the challenges in the You et al. (2021) study was that sequences in the majority of samples either approximated those of Physoderma or were close to the pea (Pisum sativum) Ascochyta blight pathogen, Didymella, specifically to Didymella pinodes/Phoma pinodella. In that study, sequences developed from disease tissues from partial ITS1-5.8S-partial ITS2, from 18S-ITS1-5.8S-ITS2-part of 28S, and LSU (S28) were used to confirm Physoderma, instead of Olpidium, as actual cause of FBG.

In fact, You et al. (2021), using ITS, LSU, and SSU, found: (i) that within sequences from ITS region about 39% were close to the genus Didymella, 20% close to Phoma, and about 14% close to Mycosphaerella; (ii) that within sequences from the LSU gene about 53% were close to genus Didymella; and (iii) that within sequences from the SSU gene that those in 5% were close to Boeremia. Specifically, from 27 test sample sequences from partial 18S-ITS1-5.8S-ITS2-partial 28S, 22 test sequences were close to Didymella, while from 47 test sequences from LSU (S28), 21 sequences were close to Didymella. The magnitude of the challenge is highlighted by the fact that what was purported to be O. viciae (HQ677595 in National Center for Biotechnology Information) from FBG in China was close to Didymella and Cercospora according to its sequences. That You et al. (2021) found one or more of Didymella in particular, but also Mycosphaerella and Phoma, present as an accompanying pathogen and/or from secondary infection in the test samples was unexpected. Not only were Ascochyta blight symptoms not evident in plants from which the You et al. (2021) test samples were derived, but the Didymella sp. known to be present in the faba bean fields causing blight is a different species (recorded as Ascochyta fabae), and while previously considered as a minor disease in Ethiopia (Tadesse et al. 2008), more recent studies highlight it as a major constraint for faba bean production in Northwestern Ethiopia (Tessema et al. 2021).

In contrast to faba bean Ascochyta blight, the field pea Ascochyta blight complex involves a range of different pathogens, including A. pinodes (teleomorph: Didymella pinodes, syn. Mycosphaerella pinodes), Phoma pinodella (syn. Phoma medicaginis var. pinodella, but historically reported as A. pinodella), A. pisi (Hagedorn 1984; Khan et al. 2013; Onfroy et al. 1999), and, in recent decades, Phoma koolunga (Davidson et al. 2009; Tran et al. 2014). The above field pea Ascochyta blight complex pathogens can cause foliar, root, and epicotyl disease symptoms (Tran et al. 2016). Field pea Ascochyta blight can be serious, such as in central highlands of Ethiopia (Fikere et al. 2010), with yield losses up to 50% or more where most severe (Gorfu 2001) and can even reduce yields by 20 to 30% under moderate severity (Amare and Beniwal 1988). For every unit increase in Ascochyta blight disease severity there can be up to a 39 kg/ha loss in field pea grain yield (Tegegna and Teshome 2017). Ascochyta blight diminishes the benefits of field pea for soil fertility restoration and as a rotation break crop to minimize negative impacts of cereal-based monocropping (Angaw and Asnakew 1994).

Using molecular sequences derived from FBG symptomatic tissue from the LSU (S28) gene, we developed and now report the first specific primers that identify P. viciae and clearly separate its identity from the confounding presence of Didymella/Phoma. Additionally, we highlight for the first time, the almost universal, but symptomless, presence of the field pea Ascochyta blight pathogen complex within faba bean plants infested by P. viciae. We then emphasize and describe the importance of historical evidence confirming such unique symptomless pathogen associations in other legumes, such as subterranean clover (Trifolium subterraneum). Finally, we show the relevance of and implications for rotations involving different legume crop and/or forage legume genera. We believe that the current study not only provides the first plausible explanation for the widespread occurrence of components of the field pea Ascochyta blight pathogen complex even in the absence of field pea cropping for many years but highlights significant implications for rotations involving different legume crop and/or forage legume genera.

In the current study, details of disease symptoms and collection of FBG DNA samples onto separate GE Healthcare Whatman FTA Cards (Fisher Scientific, Singapore) are as reported earlier in You et al. (2021). FTA Cards were exported from Ethiopia under an Ethiopian Biodiversity Institute Material Export Permit (reference no. EBI71/2553/2011) and subsequently imported into Australia under an Australian Government, Department of Agriculture and Water Resources Import Permit no. 0002826465 (You et al. 2021). In Australia, DNA was extracted from FTA Cards carrying pathogen DNA using a modified method of Ahmed et al. (2011), as described in detail in You et al. (2021) and with PCR products subsequently sequenced by Macrogen Inc (Korea). In the same way as reported in earlier studies of You et al. (2021), primer pairs were used to amplify small subunit (SSU) (James et al. 2006); internal transcribed spacer (ITS) region (ITS1 to ITS4) (White et al. 1990); and nrLSU (Rehner and Samuels 1994; Stielow et al. 2015; Vilgalys and Hester 1990) (Fig. 1).

Download as PowerPoint

To design specific primers and to amplify the target gene, sequences of 28 isolates amplified from LROR to LR5 of the LSU gene were chosen for multiple alignment (alignment type: global alignment with free end gap; cost matrix: 65%; similarity 5.0/–4.0). The consensus was used for specific primer design using “Geneious Prime Version 2020.03”. All primer combinations obtained were optimized based on orthogonal experimental design, resulting in 50 combination pairs. All pairs were checked to eliminate complementary regions and define G/C content and melting temperatures (Tm). All primer pairs were optimized for their annealing temperatures for PCR. Their final sequence alignment is shown in Figure 2.

Download as PowerPoint

To validate the specific primers, all 50 pairs of potential primers were tested with a range of DNAs extracted from 60 isolates of fungal pathogens that included 34 isolates of P. viciae. This range of fungal pathogen and host DNA used for testing specific primers was chosen to include pathogens identified in earlier studies of CABI (2012) and You et al. (2021) and/or pathogens with a reasonable likelihood of being present in the vicinity of fields used for faba bean cropping (see Table 1 for detailed list of fungi and numbers of isolates of each; all test isolate DNAs were from previously used pure fungal isolates originating from Western Australia with the exception of the imported DNAs from FBG-infested tissues extracted in Ethiopia, the latter as reported earlier by You et al. (2021)). Importantly, sample sequences that grouped with Physoderma in the earlier study of You et al. (2021) are deposited in GenBank (accession nos. MW414613–MW414631, MW448404–448414, MW497579–MW497587, and MW587325–MW587329).

Table 1. The range of fungal pathogen species and host DNA used for testing specific primers and the numbers of isolates of each tested^a

Scientific name	Number of isolates tested
Hyaloperonospora brassicae	1
Erysiphe cruciferarum	2
Neopseudocercosporella capsellae	1
Leptosphaeria maculans	4
Aphanomyces trifolii	1
Pythium irregulare	1
Macrophomina phaseolina	3
Didymella pinodella	2
Phoma medicaginis	2
Alternaria brassicae	3
Rhizoctonia solani	2
Fusarium oxysporum	1
Cercospora zonata	1
Physoderma viciae	34
Vicia faba	2
Total	60

^a These were chosen to include pathogens identified in earlier studies of CABI (2012) and You et al. (2021) or pathogens with a reasonable likelihood of being present in the vicinity of fields used for faba bean cropping and were in addition to 34 isolates of Physoderma viciae similarly tested.

View as image HTML

Two pairs of primers are reported in this study. Primer pair one, “Physo 1,” amplifies only P. viciae DNA (>300 <400 bp) (Fig. 1A), and primer pair two, ‘Physo D’, amplifies P. viciae (>400 <5,000 bp) and also Didymella pinodella (>500 <750 bp) (Fig. 1B; Table 2). The PCR conditions most suitable for primer pair “Physo 1” were as follows: 95°C for 2 min and 38 cycles of 95°C for 30 s, 61.7°C for 1 min and 72°C for 1 min. followed by 72°C for 10 min. The PCR conditions for primer pair ‘Physo D’ were 95°C for 2 min. and 38 cycles of 95°C for 1 min, 63.2°C for 1 min, and 72°C for 1 min followed by 72°C for 10 min.

Table 2. Physoderma viciae-specific primers^a

Primer name	Sequence (5′ to 3′)
Physo 1 F	ATCGGTCGATGGTGCAAACT
Physo 1 R	CTTCCGTCTTCTTGCCCCTT
Physo D F	GAGCCTCCACCAGAGTTTCC
Physo D R	CTTCCGTCTTCTTGCCCCTT

^a F = forward; R = reverse.

View as image HTML

In terms of outcomes, using DNA sequences, amplified on LSU (S28) gene, derived from FBG symptomatic tissue, we report the first pair of specific primers, ‘Physo 1’ that identifies P. viciae and ‘Physo D’, that both easily identifies P. viciae and also clearly separates its identity from the confounding presence of Didymella/Phoma. This is an enormous advance in detecting this hard-to-identify P. viciae pathogen of FBG that will now allow its easy identification without complication of other background or contaminant pathogens like Didymella/Phoma in plant samples. Additionally, we highlight for the first time the almost universal, but symptomless, presence of components of the field pea Ascochyta blight pathogen complex within faba bean infested by P. viciae. Below, we emphasize and detail the historical evidence confirming such unique association in other legumes, such as field pea and subterranean clover. This new finding has significant additional implications for rotations involving different legume crop and/or forage legume genera and provides the first plausible explanation for the widespread occurrence of the field pea Ascochyta blight pathogen complex even in situations where there has been an absence of field pea cropping for several decades.

Importantly, the current study highlights presence of Didymella as an accompanying but symptomless pathogen and/or from secondary saprophytic infection. Didymella, Mycosphaerella, and Phoma can survive saprophytically and Didymella (recorded as A. fabae) is currently a major constraint for faba bean production in Northwestern Ethiopia (Tessema et al. 2021). P. viciae, while it produces an abundance of resting spores inside the host, it only produces epibiotic zoosporangia to release zoospores for a short period. This characteristic allows ample opportunities for ‘secondary’ fungal pathogens to contaminate morphological and molecular identification procedures, leading to previous identification attempts for the FBG causal agent to show as either ‘secondary’ pathogens to FBG or as ‘other contaminating organisms.’ This is illustrated by a previously unsuccessful attempt by CABI in 2012 to identify the FBG causal agent that occurs in Ethiopia, where ITS rDNA analysis with FASTA showed >99% similarity to sequences assigned to Phoma and Peyronellaea, with 100% match to Peyronellaea pinodella (syn. M. pinodes, D. pinodes) (CABI 2012). Importantly, when DNA was extracted from many soil samples from subterranean clover forages across southern Australia by commercial Predicta B DNA extraction service operated by South Australian Research and Development Institute, Adelaide (Ophel-Keller et al. 2008), high levels of DNA of D. pinodes/P. pinodella were universally present even where there was no previous record of any field pea having been sown, highlighting the ability of D. pinodes/P. pinodella to remain present in the long or total absence of field pea (M. P. You and M. J. Barbetti, unpublished data). Interestingly, recent commercial Predicta B DNA tests of field soils in the highlands of Ethiopia showed 50% of samples had high levels of DNA of D. pinodes/P. pinodella (A. Tekalign et al. unpublished data).

Generally, emphasis has primarily been on D. pinodes in relation to field pea Ascochyta foliar disease, as it is accepted as the most destructive of the Ascochyta blight (Bretag et al. 2006; Khan et al. 2013; Le May et al. 2012; Moussart et al. 1998; Tivoli and Banniza 2007). Examples of this include on the Canadian prairies where D. pinodes is considered the principal pathogen of the Ascochyta blight complex (Gossen et al. 2011), and as is the case across southern Australia (Bretag 1991; Khan et al. 2013) and in France (Tivoli and Lemarchand 1992). The ecological balance between pathogen species involved in the field pea Ascochyta blight complex is known to be strongly influenced by cropping practices (Barbetti et al. 2021; Tran et al. 2014) with D. pinodes generally favored and afforded dominance by decisions in relation to management differences across regions (Tivoli and Banniza 2007).

In Australia, some of the same pathogens of the field pea Ascochyta blight complex had been noted during surveys of subterranean clover, such as up to 3% seed infection (Barbetti 1990) and up to 45% of isolates obtained from leaves and petioles being P. pinodella (but misnamed as P. medicaginis) (Barbetti 1985). Barbetti and Khan (1987) showed that Phoma not occurs widely across annual Medicago spp. (P. medicaginis) and subterranean clover (P. pinodella) pastures and pea (P. pinodella) crops in Western Australia and showed that cross-infection readily occurred for Medicago isolates onto Pisum and Trifolium, for Pisum isolates onto Trifolium, and for Trifolium isolates onto Pisum. Perhaps most relevant to the current study, Barbetti (1986) showed that while P. pinodella (again mistakenly listed as P. medicaginis) could colonize subterranean clover cotyledons, leaves and petioles readily throughout the growing season from as early as 1 week after emergence and onwards, it showed no propensity, under the conditions of that field investigation, to cause any discernible disease symptoms. The role of D. pinodes/P. pinodella to remain present in the long or total absence of field pea and to infect a range of different legume crops and forages has significant additional implications for rotations involving different legume crop and/or forage legume genera susceptible to one or more of the components of the Ascochyta blight complex.

In conclusion, the current study reports the first two pairs of primers, one pair ‘Physo 1’, that readily detects P. viciae and another pair ‘Physo D’, that clearly separates the identity P. viciae from the common and confounding presence of Didymella/Phoma spp. Additionally, because of these new primers, it highlights for the first time, the almost universal, but symptomless, presence of members of the field pea Ascochyta blight pathogen complex within faba bean infested by P. viciae. Further, it provides the first plausible explanation for the widespread occurrence of the field pea Ascochyta blight pathogen complex even in situations where there has been an absence of field pea cropping for many years. Finally, it highlights the need for further evaluation of the occurrence and role of seemingly ‘symptomless’ legume pathogens in Ethiopia, both in relation to faba bean crops and, more widely, across situations where crop and/or forage legumes are grown in rotation, or as mixed crop types such as faba bean/field pea mixtures, or in proximity.

Data Availability

All critical data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researcher. Sample sequences that grouped with Physoderma in the earlier study of You et al. (2021) are deposited and available in GenBank (accession nos. MW414613–MW414631, MW448404–448414, MW497579–MW497587, and MW587325–MW587329).

Acknowledgments

From Ethiopia, we also acknowledge the assistance of Drs. Fininsa Chemeda and Terefe Hbtamu, School of Plant Sciences, Haramaya University; Drs. Musa Jarso, Gemechu Keneni, and Asnakech Tekalign Beyene from EIAR Holetta Agricultural Research Centre, Holetta; and Nigussie Kefelegn, Wulita Wondwosen Kebede, and Bereket Ali, Debre Birhan Agricultural Research Centre, Debre Birhan, and Dr. Zewdie Bishaw, ICARDA, Addis Ababa. We are grateful to Dr. Chris Jones at the International Livestock Institute (ILRI) in Nairobi, Kenya, for granting us permission to use the ILRI plant pathology and molecular laboratories at ILRI, Addis Ababa. We are especially grateful to Dr. Alemayehu Teressa, ILRI laboratories, Addis Ababa, for always providing us access to all plant pathology and molecular facilities in these laboratories and with whatever assistance and requirements we needed. Finally, we are most appreciative of the comprehensive and constructive comments and suggestions of the reviewers and editors in finalizing this manuscript.