Resource AnnouncementOpen Access icon OPENOpen Access license

Complete Genome Sequence Resource for Xanthomonas translucens pv. undulosa MAI5034, a Wheat Pathogen from Uruguay

    Affiliations
    Authors and Affiliations
    • Felipe Clavijo1
    • Claudia Barrera2
    • Aleksander Benčič3 4
    • Valentina Croce1
    • Jonathan M. Jacobs5 6
    • Adriana J. Bernal2
    • Ralf Koebnik7
    • Veronica Roman-Reyna5 6
    1. 1Laboratorio de Microbiología Molecular, Departamento de Biociencias, Facultad de Química, Universidad de la República, Montevideo, Uruguay
    2. 2Department of Biological Sciences, Universidad de Los Andes, Bogotá, Colombia
    3. 3National Institute of Biology, Ljubljana, Slovenia
    4. 4Jožef Stefan International Postgraduate School, Ljubljana, Slovenia
    5. 5Department of Plant Pathology, The Ohio State University, Columbus, OH, U.S.A.
    6. 6Infectious Diseases Institute, The Ohio State University, Columbus, OH, U.S.A.
    7. 7Plant Health Institute of Montpellier, University of Montpellier, CIRAD, INRAE, Institut Agro, IRD, Montpellier, France

    Published Online:https://doi.org/10.1094/PHYTO-01-22-0025-A

    Genome Announcement

    The bacterial species Xanthomonas translucens is responsible for bacterial leaf streak and black chaff of small grains and bacterial wilt of forage grasses (Egli et al. 1975; Jones et al. 1917; Sapkota et al. 2020; Vauterin et al. 1995). In particular, bacterial leaf streak of wheat represents the most limiting bacterial disease in wheat production worldwide (Duveiller et al. 1997). The X. translucens pathovar most commonly associated with wheat is pathovar undulosa (Smith et al. 1919).

    Until recently, genome sequences of 61 strains were available for this species at NCBI GenBank, 16 of which are complete genomes. Only one X. translucens genome sequence from a South American strain, UPB787, is currently available, which was isolated from barley in Paraguay in 1990. To enlarge the geographic coverage of the pathogen’s genomic resources, we present the first complete genome sequence of a South American strain of X. translucens, which reveals a surprising conservation of its repertoire of transcription activator-like effectors (TALEs) across continents.

    Strain MAI5034 was isolated in October 2018 from symptomatic wheat leaf tissue obtained in Soriano, Uruguay (Clavijo et al. 2022). Pathogenicity on wheat was confirmed in greenhouse assays. The strain was identified as X. translucens pv. undulosa by multilocus sequence analysis of the concatenated partial sequences of four housekeeping genes (dnaK, fyuA, gyrB, and rpoD) and, through multilocus sequence typing, it was assigned to novel sequence type ST3 (Clavijo et al. 2022).

    Strain MAI5034 was grown at 28°C on peptone-sucrose-agar medium (0.5% peptone, 2% sucrose, and 1.5% agar) for 24 h. Bacteria were then resuspended in 10 mM MgCl2 and diluted to an optical density at 600 nm of 1.0. Cells from 2 ml were harvested by centrifugation and washed once with 10 mM MgCl2, and genomic DNA was isolated using Qiagen Genomic tip 100/G (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.

    For library construction and DNA sequencing, performed by ohmX.bio (Gent, Belgium), 1 μg of DNA was mechanically fragmented with g-Tubes (Covaris) at approximately 13 kb. A sequencing library was prepared with the Ligation Sequencing kit (SQK-LSK110; Oxford Nanopore Technologies [ONT]) and the Native Barcode Expansion (PCR-free) (EXP-NBD114; ONT) based on the manufacturer’s protocol. For multiplexing with other samples, a unique barcode (barcode ID NB19, GTTCCTCGTGCAGTGTCAAGAGAT) was ligated to the sample type using the ONT direct-DNA (SQK-LSK109) library preparation kit in combination with the Native barcoding expansion (EXP-NBD104). Upon pooling of eight libraries, samples were sequenced on a GridION, R9.4 flow cell, and sequence reads were demultiplexed by ohmX.bio and provided as FASTQ files.

    Sequence reads were trimmed with Porechop (v0.2.4) and assembled using three different algorithms: Flye (version 2.8.1-b1676), Shasta, and Miniasm (Kolmogorov et al. 2020; Li 2016; Shafin et al. 2020; Wick 2017). In addition, the Flye and Miniasm assemblies were polished using Racon (Vaser et al. 2017). A comparison of these assemblies revealed the superior performance of the Racon-polished Flye assembly, as indicated by its better contiguity, completeness, and quality (Supplementary Table S1). However, manual inspection revealed significant issues with homopolymeric nucleotide runs, resulting in four frame shifts per TALE gene. Therefore, we applied Homopolish (version 0.0.1) on the Racon-polished Flye assembly (Huang et al. 2021), which resolved all of the problems at the TALE genes and reduced the number of predicted pseudogenes from 315 to 202 (see below).

    This procedure yielded one circular chromosome of 4,625,916 bp with a typical G+C content of 64.7%, corresponding to 139× sequencing coverage. The chromosome was annotated with GeneMarkS-2+ (Lomsadze et al. 2018), as implemented in the NCBI Prokaryotic Genome Annotation Pipeline (https://www.ncbi.nlm.nih.gov/genome/annotation_prok/), which predicted a total of 4,001 genes, including 3,736 coding genes, 202 pseudogenes, 53 transfer RNA genes, 4 noncoding RNAs, and 2 rRNA operons (5S, 16S, and 23S).

    Type 3 effectors and, in particular, TALEs, are of specific interest when trying to understand the pathogenicity of xanthomonads and their host adaptation (Boch and Bonas 2010; Jacques et al. 2016; White et al. 2009). For this reason, TALEs were predicted and classified using the AnnoTale suite (Grau et al. 2016). In total, seven TALE genes were found, belonging to the classes TalCT, TalCZ, TalDA, TalDC, TalDD, TalDE, and TalDF, all of which are widely conserved in strains of X. translucens pv. undulosa (Table 1; Fig. 1) (Falahi Charkhabi et al. 2017; Peng et al. 2016; Shah et al. 2021), arguing for a recent worldwide expansion of this pathovar (Khojasteh et al. 2019). Notably, a homolog of the tal8 gene in strain Xtu4699, which elevates expression of a 9-cis-epoxycarotenoid dioxygenase gene (TaNCED-5BS) in wheat, that encodes the rate-limiting step in the biosynthesis of the phytohormone abscisic acid for disease susceptibility (Peng et al. 2019), is present in strain MAI5034 (talDC). Two additional genes that contribute to virulence of strain ICMP 11055 are less conserved (Falahi Charkhabi et al. 2017). Whereas tal4b (talHM) is absent in strain MAI5034 and other strains of X. translucens pv. undulosa (Peng et al. 2016; Shah et al. 2021), strain MAI5034 encodes a novel allele of tal2, talDD.

    Table 1. Repeat-variable diresidue (RVD) sequences of completely sequenced Xanthomonas translucens pv. undulosa strainsa

    Fig. 1.

    Fig. 1. Phylogenetic tree of Xanthomonas translucens pv. undulosa strains and repertoire of transcription activator-like (TAL) effector genes. Genome sequences were retrieved from GenBank (Sayers et al. 2022): ICMP 11055 (CP009750), XtKm15 (CP063997, CP063998, CP063999), XtLr8 (CP063993, CP063994, CP063995), Xtu4699 (CP008714), MAI5034 (CP089584), XtFa1 (CP063996), XtKm12 (CP064000), LW16 (CP043540), and P3 (CP043500). Calculation of genome-wide pairwise average nucleotide identities and phylogenetic analysis were performed on the enve-omics platform (http://enve-omics.ce.gatech.edu) (Rodriguez-R and Konstantinidis 2016). The unweighted pair-group method with arithmetic mean was used to build the phylogenetic tree (Sokal and Michener 1958). The interactive Tree Of Life suite was used for better visualization of the tree (https://itol.embl.de; Letunic and Bork 2019). Open rectangles symbolize the chromosomes of the X. translucens strains. For better comparability, genome sequences were rotated so that they start with the translation initiation codon of the dnaA gene. Position and orientation of TAL effector genes, as classified by the AnnoTale suite (Grau et al. 2016), are indicated by colored arrows. TAL effector genes are not drawn to scale. Genes encoding TalCZ in strains XtKm15 and XtLr8 are interrupted by the insertion of an IS element.

    Download as PowerPoint

    The lower diversity of TALE repertoires in the pathovar undulosa as compared with the pathovar translucens is also mirrored by their lower genetic diversity, which was observed in a cohort of 178 strains of small-grain-infecting xanthomonads (Khojasteh et al. 2019) and may support the hypothesis that the pathovar undulosa emerged or originated from the pathovar translucens. Such a scenario is also supported by the observation that the cbsA gene, a genetic switch between vascular and nonvascular plant pathogenesis (Gluck-Thaler et al. 2020), is disrupted by an IS1595-family transposase in strain MAI5034 and other strains of X. translucens pv. undulosa, ultimately resulting in nonsystemic infection.

    Data Availability

    Raw reads and the complete genome were uploaded to the NCBI Sequence Read Archive and GenBank under BioProject accession PRJNA786744.

    Acknowledgments

    We thank J. Grau, Martin-Luther-Universität Halle-Wittenberg, Germany, for assistance with the AnnoTale suite.

    The author(s) declare no conflict of interest.

    Literature Cited

    R. Koebnik and V. Roman-Reyna contributed equally to this work.

    Funding: Support was provided by the Institut de Recherche pour le Développement, France, for the North-South-South Network on Xanthomonads within the International Scientific Coordination Network-South (GDRI-Sud NSSN-X); the European Cooperation in Science and Technology (COST) Programme for support of A. Benčič and R. Koebnik through the EuroXanth COST Action CA16107, which was key in initiating this collaborative genome project; the American Malting Barley Association funding to J. M. Jacobs; the Faculty of Sciences at Universidad de los Andes to A. J. Bernal; and the Slovenian Research Agency to A. Benčič.

    The author(s) declare no conflict of interest.