Development of Genome-Driven, Lifestyle-Informed Markers for Identification of the Cereal-Infecting Pathogens Xanthomonas translucens Pathovars undulosa and translucens

Xanthomonas translucens is a bacterial plant pathogen that impacts global cereal and grass production (Sapkota et al. 2020). For cereals, X. translucens causes multiple diseases, such as bacterial leaf streak and bacterial blight of leaves and black chaff on seeds (Bragard et al. 1995, 1997; Jones et al. 1916; Smith et al. 1919). Reports indicate that X. translucens infection can lead to a 40% yield reduction or 8 to 13% losses in kernel weight (Forster 1988; Shane et al. 1987; Tubajika et al. 1998). In the United States, X. translucens is present in several states, with ongoing outbreaks across the Northern Great Plains, but the current economic and yield impacts of these diseases remain unreported (Adhikari et al. 2012; Curland et al. 2018; Kandel et al. 2012).

Control of diseases caused by X. translucens is limited. As with most bacterial pathogens, antibiotic applications are not effective, and copper-based control is discouraged as many Xanthomonas species display tolerance or acquire horizontally transferred resistance (Lamichhane et al. 2018). Moreover, major-gene plant disease resistance to X. translucens diseases is not available in commercial U.S. cereal production. X. translucens has been identified as a seedborne pathogen, but it remains unclear which pathovars are seed-transmitted (Duveiller 1990). These multiple barriers to the successful management of X. translucens pathovars in crops and the recent reports of economically significant disease pressure create an urgent need for discovery of resistance sources (Adhikari et al. 2012; Alizadeh et al. 1994; Curland et al. 2018, 2020a; Duveiller et al. 1992).

Historically, X. translucens taxonomy is based on host specificity, which dictates pathovar nomenclature (Bradbury 1986; Bragard et al. 1995; Curland et al. 2020a; Ledman et al. 2021). This host-range-based classification system currently describes 10 pathovars. The main four cereal-infecting pathovars are translucens, undulosa, cerealis, and secalis (Supplementary Table S1). An additional five pathovars (graminis, arrhenatheri, phleipratensis, poae, and phlei) infect wild grasses, forage grasses, and other monocots (Supplementary Table S1). X. translucens pv. pistaciae was isolated from the dicot pistachio, but recent genetic analysis demonstrated that this pathovar spans two pathovars; one isolate is closer to pathovar cerealis, whereas another isolate is closer to pathovar translucens (Giblot-Ducray et al. 2009; Goettelmann et al. 2022).

Recent efforts in genome sequencing and phylogenomic analysis have enabled the reclassification of X. translucens based on evolutionary relationships into three genomic groups I-III (Goettelmann et al. 2022; Heiden et al. 2022; Sapkota et al. 2020). Cereal-infecting pathovars (secalis [Xts], translucens [Xtt], and undulosa [Xtu]) belong to genomic group Xt-I (Goettelmann et al. 2022). The Xt-I group was also defined using the Life Identification Number (LIN) classification system that provides an average nucleotide identity (ANI)-based coding system to precisely identify genomic subgroups (Heiden et al. 2022; Tian et al. 2020). According to the LINbase classification, all Xt-I group strains are 96% genomically identical. Xtt is the primary pathogenic agent of barley and does not cause disease on wheat but has been sporadically isolated from wheat (Curland et al. 2018). Xtu infects a broad range of hosts (e.g., wheat, barley, and cultivated wild rice [Zizania palustris]) but is most often associated with bacterial leaf streak on wheat (Bragard et al. 1997; Curland et al. 2018, 2021). Xtt colonizes both the host vascular xylem and nonvascular spongy mesophyll tissue, whereas Xtu remains localized to the nonvascular system (Gluck-Thaler et al. 2020). Gluck-Thaler et al. (2020) showed that the single gene, cbsA, coding a GH6-family cellobiohydrolase, was only present in vascular Xanthomonas species including Xtt (Gluck-Thaler et al. 2020). Evolutionary-based genomic analysis, or phylogenomics, demonstrated that pathovar typing often incorrectly categorizes pathogens, which can bring further implications (Goettelmann et al. 2022; Heiden et al. 2022). For example, host-based nomenclature might misidentify the genetic subgroup and overlook pathogen-host adaptation. Historical pathovar identifications in X. translucens were often assumed from the host of origin rather than conducting a rigorous host range analysis (Langlois et al. 2017; Rademaker et al. 2006; Vauterin et al. 2000). Xts is considered a separate pathovar because of its isolation from rye, but this X. translucens pathovar is genomically nested in the subgroup Xt-I-Xtu and infects wheat (Bragard et al. 1995; Goettelmann et al. 2022; Reddy et al. 1924).

Early diagnosis and surveillance can be used to predict outbreaks, potential yield loss, and seed transmission. Currently published methods for X. translucens diagnostics include loop-mediated isothermal amplification (LAMP), polymerase chain reaction (PCR), and quantitative PCR (Langlois et al. 2017; Sarkes et al. 2022). PCR diagnostics using the gyrase B gene (gyrB) to identify Xanthomonas species do not have the specificity to differentiate X. translucens pathovars (Parkinson et al. 2009). A LAMP assay developed by Langlois et al. (2017) is the most current method for rapid X. translucens group differentiation, but this assay cannot distinguish between Xtu and Xtt. Additionally, multilocus sequence analysis (MLSA) of four housekeeping genes has been shown to differentiate between Xtt and Xtu; however, as MLSA relies on generating and analyzing sequence data, it can be time consuming and costlier than PCR detection assays (Curland et al. 2018, 2020b; Ledman et al. 2021). Currently, there are no rapid molecular methods publicly available to differentiate Xtt and Xtu.

In this study, we developed a multiplex PCR to detect and differentiate Xtt and Xtu using evolutionary and lifestyle-informed primers (Fig. 1). We set a foundation based on whole-genome sequencing-based differentiation and then used these genomic separations to develop primers unique to Xtu. The selected gene targets are associated with the pathogenic behaviors (vascular and nonvascular) of these X. translucens pathovars. We validated the primer efficacy using pure bacterial cultures covering non-Xanthomonas, Xanthomonas spp., and X. translucens diversity across three independent laboratories. We then tested the primers using bacterial isolates from field samples. Our diagnostic tool improves X. translucens pathovar identification using pathogen genetic diversity.

Download as PowerPoint

Materials and Methods

Whole-genome analysis

To capture the genetic diversity of X. translucens, 24 genomes were selected from different X. translucens strains. The 24 genomes include 14 strains from the Xt-I group, three from Xt-II, and seven from Xt-III (Supplementary Table S2). The nucleotide data for each genome were obtained from GenBank, and their GenBank accession numbers are reported in Supplementary Table S2. ANI was calculated with the tool Genome Matrix from Enveomics (http://enve-omics.ce.gatech.edu/g-matrix/). To obtain an Xt-unique LIN, we first created an account on the LINbase website (https://linbase.org/LINbase/index.php). Then, we used the option “Upload” to upload and submit an Xt genome to the website. Bacterial classification is based on genomes available in LINbase. After 5 to 10 min, the website provides a unique LIN number (“New Genome”), the “Most similar bacterial genome based on ANI” (Best match), and LIN numbers for related genomes. Once a user creates an account, they can access all LIN numbers and search for other X. translucens using the option “Search”.

Bacterial strains

For primer validation, three bacterial groups were tested: (i) non-Xanthomonas plant pathogens, (ii) Xanthomonas spp., and (iii) X. translucens pathovars (Tables 1 and 2). The non-Xanthomonas strains were selected because they have been reported as rice or corn pathogens, non-cereal pathogens, or environmental isolates. The Xanthomonas spp. strains were selected to represent clade I and II Xanthomonas including Xanthomonas species reported as cereal pathogens or barley commensals (Egorova et al. 2014). The X. translucens pathovar strains were selected to represent older and recently collected Xtu and Xtt isolates.

TABLE 1. List of non-Xanthomonas plant pathogen strains and Xanthomonas spp. strains tested with multiplex primers

Species	Strain	Source
Pseudomonas syringae pv. glycinea	PsgR4 (PPY424)	Kobayashi et al. 1989
Enterobacter spp.	No strain recorded	Schwartz and Otto 2000
Clavibacter nebraskensis	CO-428	Lang et al. 2017
Pseudomonas fuscovaginae	SE-1	Ash et al. 2014
Pantoea stewartii	369	Coplin et al. 2002
Xanthomonas sacchari	Q45445	Provided by APHIS
Xanthomonas hortorum pv. vitians	B59	Morinière et al. 2020
Xanthomonas hyacinthi	CFBP 1156	Cohen et al. 2020
Xanthomonas theicola	CFBP 4691	Koebnik et al. 2021
Xanthomonas prunicola	CIX383	Clavijo et al. 2022

View as image HTML

TABLE 2. Xanthomonas translucens (Xt) strains used to test multiplex primers

Clade	Xt pathovar	Strain	Publication
Xt-I	translucens	CFBP 2054	Jones et al. 1916
		UPB787	Bragard et al. 1997
		UPB886
		UPB545
		CIX87	Curland et al. 2018; Ledman et al. 2021
		CIX95
Xt-I	undulosa/secalis	CIX32
		CIX40
		CIX184
		CIX354
		UPB882	Bragard et al. 1997
		UPB513
Xt-II	cerealis	NCPPB1943	Chaves and Mitkowski 2013
Xt-III	phleipratensis	UPB441	Bragard et al. 1997
	graminis	CFBP 2053	Pesce et al. 2015
	arrhenatheri	UPB455	Bragard et al. 1997

View as image HTML

To test the primers on bacteria from field samples, X. translucens was isolated from 10 dried barley leaves donated by producers. The leaves were collected in Idaho in 2019. The barley leaves were wiped with 70% vol/vol ethanol, and 1 cm² of barley leaf tissue was added to 300 µl of sterile water. Sample suspensions were incubated at room temperature for 30 min. After incubation, 30 to 50 µl of the liquid was streaked on nutrient agar (NA) plates and incubated for 2 days at 28°C. Each colony with a Xanthomonas-like phenotype was resuspended in 10 µl of sterile water. Five microliters of the water-suspended colony was blotted on NA, and the remaining 5 µl was added to a PCR tube with 5 µl of TE-T (20 mM Tris-Cl, pH 8; 2 mM EDTA, pH 8; 0.1% Triton X-100) solution. The resulting colony suspension was used for multiplex PCR (cbsA and S8.pep primers) as described below. We validated our approach with amplification and sequencing of gyrB using previously published PCR primers (Parkinson et al. 2009). If colony suspension was confirmed to be X. translucens, 5 µl was added to 500 µl of 20 to 25% sterile glycerol for storage at −80°C.

Primer design

To differentiate among X. translucens pathovars, multiplex PCR primers were designed based on cbsA, a gene encoding glycosyl hydrolase 6-family cellobiohydrolase. The gene cbsA is associated with a bacterial adaptation in colonization of the plant vascular tissue, and only a fragment remains in wheat-infecting Xtu (Gluck-Thaler et al. 2020). The sequence of cbsA from Xtt UPB 886 (NCBI protein id: MQS43189.1) was used as a BLASTn query to search for all the X. translucens cbsA alleles on the NCBI platform. The search included the following parameters: “complete and draft genomes” from “Xanthomonas translucens (taxid: 343)” as the dataset and “discontiguous megablast (more dissimilar sequences)” as the BLAST algorithm. The cbsA sequences from 24 different X. translucens strains were aligned and visualized with NCBI Multiple Sequence Alignment Viewer v1.20.1 using default settings. The phylograms were edited in FigTree v1.4.4 (https://github.com/rambaut/figtree/releases). The cbsA alleles from six different X. translucens pathovars were aligned to manually design two pairs of primers for conventional multiplex PCR. Based on the length and nucleotide diversity of cbsA, four primers (cbsA-1, cbsA-2, cbsA-3, cbsA-4) were manually designed to amplify the intact cbsA in Xtt, Xt-II, and Xt-III and the truncated cbsA fragment in Xtu. The combinations of the cbsA primers were kept to (i) amplify all X. translucens subgroups (Xt-I to Xt-III) and cover pathogen movement and potential host jumps; (ii) consider the single-nucleotide polymorphisms and cbsA gene length differences in Xt subgroups; and (iii) cover potential mixed infections of Xt-I with another Xt subgroup (Xt-II or Xt-III).

Xtt and Xtu both amplified a 165-bp cbsA fragment (600 and 800 bp are Xtt unique) and therefore could not be distinguished from a mixed infection. Therefore, a third set of primers was designed based on unique Xtu genes. Seven Xtt strains (UPB 458, UPB 886, UPB 787, XtKm34, CIX95, CIX43, and CFBP 2054) and seven Xtu strains (LW16, XtKm12, ICMP11055, P3, 4699, UPB 513, and CFBP 2539) were selected to identify unique genes. The 14 complete genomes were annotated with Prokka v1.14.5 (Seemann 2014). The software Roary (v3.13.0) was used to compare the predicted proteins of all genomes and identify unique Xtu coding genes (Page et al. 2015). The software Mauve (v2015) was used to manually validate Roary results (Darling et al. 2004). From the list of validated unique genes, primers were designed using PrimerBLAST (Ye et al. 2012). Primer Pair Specificity Checking Parameters were changed to have a nonredundant database (nr) and “Xanthomonas translucens” as the organism. The parameters were modified to exclude other X. translucens genomes on NCBI.

PCR amplifications

Bacterial colonies were used as a template for PCR assays using a method adapted from Cormican et al. (1995). Briefly, a 1-µl loopful of each bacterial colony was taken from a 2-day-old culture grown on NA. The colonies were resuspended in 100 µl of sterile water. Twenty microliters of the bacterial suspension was mixed with 20 µl of TE-T solution and incubated for 10 min at 95°C. The bacterial suspension was vortexed, and 2 µl was used as the template in a 25-µl PCR.

Multiplex PCRs with the three primer pairs were performed in a 25-µl reaction containing 0.08 µM each of primers cbsA-1, cbsA-2, cbsA-3, and cbsA-4; 0.16 µM S8-protease primers; 12.5 µl of Quick-Load Taq 2× Master Mix (M0271L, New England Biolabs), and 2 µl of template (colony resuspended in TE-T). For the gyrB PCR, 25-µl reactions contained 0.08 µM gyrB primers (Parkinson et al. 2009), 12.5 µl of Quick-Load Taq 2× Master Mix, and 2 µl of template. All PCR products were run in 0.7% agarose gels using 100 V for 50 min and visualized under blue light with EZ-Vision Bluelight DNA dye 10,000× (VWR). The thermocycling conditions for all PCRs were as follows: (i) initial denaturation at 95°C for 30 s, (ii) 30 cycles at 95°C for 30 s, 50°C for 45 s, and 68°C for 1 min, (iii) final extension at 68°C for 5 min, and (iv) final temperature 10°C for 10 min.

Cross-laboratory validation of X. translucens multiplex PCR

To evaluate the multiplex PCR reproducibility, we tested the protocol at three additional laboratories beyond The Ohio State University: the University of Minnesota, Colorado State University, and the University of British Columbia. Each laboratory followed the PCR protocol and used the reagents described above. All laboratories included water as a negative control. The PCR for the University of Minnesota included three control strains (Xtc LMG 679, Xtu LMG 892, and Xtt LMG 876) and four strains isolated in Minnesota (Xtu CIX23, Xtt CIX43, Xtt CIX86, and Xtt CIX94). Colorado State University had one control strain (Xtt LMG 876) and two strains isolated from Colorado (Xtt CO 236 and Xtu CO 237). The University of British Columbia used two controls (Xtt LMG 876 and Xtu LMG 892) and five strains isolated in British Columbia (Xtt-1, Xtt-2, Xtt UBC 026, Xtt UBC 028, and Xtt UBC 029).

Results

Whole-genome comparisons

To establish the genomic similarities among X. translucens pathovars, we compared whole genomes of 24 different X. translucens strains using ANI (Fig. 2). As mentioned above, Goettelmann et al. (2022) previously identified three X. translucens clades (I, II, and III) based on ANI. Our phylogenomic analysis agreed with their findings that Xt-I includes only Xtt and Xtu (Fig. 2). As expected, LIN classified these 24 genomes under the same genus and species and genomic groupings (I-III) based on a 95% genome identity threshold. Xtt and Xtu were 97% similar but in distinct LIN subgroups (LIN values I0 and I1, respectively) at the 98% threshold (Fig. 2). The limited genomic diversity of the X. translucens strains allowed us to design unique primers to differentiate Xtt from Xtu.

Download as PowerPoint

Evolutionary genomics- and lifestyle-informed primers

To evaluate cbsA gene diversity across X. translucens groups, we compared the cbsA gene from the three X. translucens genomic clades I to III (Fig. 3A). To represent the three clades, we used the 24 X. translucens genomes used in our genomic comparison analysis (Fig. 2) and created a phylogenomic tree based on the BLASTn cbsA aligned sequences. The cbsA tree displayed a similar organization to the whole-genome comparison tree, agreeing with previous findings that cbsA is an ancestral X. translucens feature (Figs. 2 and 3A) (Gluck-Thaler et al. 2020).

Download as PowerPoint

Alignment of the cbsA alleles revealed that the gene sequences varied in length across genomic groups (Fig. 3B). In Xt-I-Xtu, cbsA was pseudogenized by a transposon, and only a 165-bp fragment remained in the genome (Gluck-Thaler et al. 2020). For Xt-I-Xtt and Xt-III, the cbsA length is 1,425 bp, and the Xt-II cbsA is 1,394-bp long. The genetic variation in cbsA among clades allowed for three different PCR amplicon profiles, using the four cbsA primers: Profile 1 = three bands (165, 600, and 800 bp) for Xtt complete cbsA; Profile 2 = one band (165 bp) for Xtu truncated cbsA; and Profile 3 = one band (600 bp) for Xt-II or -III cbsA. We confirmed the size and targeted sequences for the cbsA primers throughout Sanger sequencing (Supplementary Fig. S3).

Genome-informed primers

The two sets of cbsA primers were unable to resolve a mixed Xtt-Xtu infection. Therefore, to detect mixed infections of the two pathovars, or to differentiate their presence in the same field, we designed an additional primer set based on a unique Xtu gene.

Through the comparative genomic analysis of amino acid sequences of Xtt and Xtu, we identified 67 unique Xtu genes and selected 13 annotated genes with a known function (not hypothetical genes) to design the primers (Table 3; Supplementary Table S2). Based on PrimerBlast results, we selected primers for four genes unique to Xtu genomes that were not present in other X. translucens pathovars. Only one primer pair of the four tested (S8.pep-F and S8.pep-R) was Xtu-specific, generating a distinct band (Supplementary Fig. S1). This gene target encoded an S8 family peptidase (WP_003469260 from the Xtu ICMP11055 NCBI genome) (Table 3). The role of this gene in Xtu-host interactions remains unknown.

TABLE 3. Primer sequences for multiplex PCR

Gene type, gene name, RefSeq sequence	Primer name: sequence (5′-3′)	Annealing temperature	Amplicon (bp)
Lifestyle-informed, cbsA, WP_003476231	cbsA-1: TCACTTTTCCGCTTGCTCGTTG	50°C	Xtt: 165, 600, and 800 bp
	cbsA-2: ATGTGCGACCCTACCTATAC		Xtu: 165 bp
	cbsA-3: TGAGGAAGGCATCAAGTACGCA		Other Xt: 600 bp
	cbsA-4: CCTGGCTGTTTGACGAATGCAT
Xtu unique gene, S8 peptidase, WP_003469260	S8.pep-F: GACAGGGTCACGTTGGCATA	50°C	Xtu: 450 bp
	S8-pep-R: CCTCCAATCAGTTCCCGGTC

View as image HTML

Primer validation

To test our primers and their specificity for Xtt and Xtu, we carried out a colony-based multiplex PCR using cbsA-1, cbsA-2, cbsA-3, cbsA-4, S8.pep-F, and S8.pep-R. PCR amplification of the three multiplexed primer sets from lysed colonies that yielded two band patterns that differentiated between the six Xtt and six Xtu strains tested (Fig. 4). For all Xtt strains, three bands were present (800, 600, and 165 bp), whereas the multiplex PCR for all Xtu strains amplified two fragments (450 and 165 bp). We also were able to detect a mixed Xtt-Xtu colony PCR with a total of four bands (Fig. 4). This PCR primer set also differentiated X. translucens genomic groups Xt-II and Xt-III from Xtt and Xtu (Fig. 5).

Download as PowerPoint

Download as PowerPoint

To test the specificity of the primers against non-Xanthomonas plant pathogens, we selected five different bacterial species (Pseudomonas syringae pv. glycinea, Enterobacter spp., Clavibacter nebraskensis, Pseudomonas fuscovaginae, and Pantoea stewartii) (Table 1; Fig. 5). Two strains (P. syringae pv. glycinea [PsgR4] and Enterobacter spp.) presented some PCR amplification based on the multiplex PCR results, but the band sizes of these organisms did not correlate with the X. translucens multiplex PCR profile with bands at 200 and 700 bp, respectively. Amplification of five additional Xanthomonas species (X. sacchari, X. hortorum, X. hyacinthi, X. theicola, and X. prunicola) (Tables 1 and 2) yielded a band profile that did not match the X. translucens multiplex profile (Fig. 5).

The multiplex PCR was validated in three different laboratories (University of Minnesota, Colorado State University, and University of British Columbia). In all three laboratories, the multiplex PCR separated Xtu from Xtt, with consistent band size profiles for the controls and local and historical isolates (Supplementary Fig. S2).

Bacteria isolated from field samples

The 10 barley leaf samples received from growers yielded a total of 17 bacterial colonies with Xanthomonas-like morphology. Fifteen of these colonies were identified as a Xanthomonas sp. based on the PCR that amplified a fragment of the gene gyrB. The gyrB PCR product has a single 700-bp band for the genus Xanthomonas.

The multiplex PCR indicated that 12 of the 15 Xanthomonas-positive colonies were X. translucens pv. translucens (Fig. 6B). Colonies C13 and C14 were identified as Xanthomonas sp. but not X. translucens; therefore, the gyrB PCR products for both colonies were sequenced. Both fragments had 98.79% identity to X. hortorum based on a BLASTn search with the nr/nt database.

Download as PowerPoint

Discussion

Disease symptoms provide critical information to describe pathogen behavior in agricultural ecosystems. The long history of pathogen typing using pathovar nomenclature provided foundational knowledge to characterize Xtt and Xtu vascular and nonvascular lifestyles and host range (Curland et al. 2020a; Gluck-Thaler et al. 2020). This pathovar designation informed previous research that characterized cbsA as a vascular pathogen-specific gene and was the first template for designing a multiplex PCR in this study (Gluck-Thaler et al. 2020). We then used comparative genomics with knowledge about pathogen phenotypes to identify Xtu-unique genes and improve our diagnostic primers (Lang et al. 2010).

The Xanthomonas genus includes additional species with pathovars that cause respective vascular and nonvascular symptoms on a similar host, such as X. campestris pv. campestris and X. campestris pv. raphani on brassicas or X. oryzae pv. oryzae and X. oryzae pv. oryzicola on rice. cbsA is present in these vascular Xanthomonas spp. but is absent from nonvascular subgroups. As in Xtu, related nonvascular subgroups lack cbsA or have a truncated form of the gene. Therefore, cbsA was a prime candidate for differentiating Xtu and Xtt pathovars for diagnostics and proved effective for pathovar differentiation in other related groups of Xanthomonas plant pathogens.

In the past, X. translucens pathovars were defined primarily by their isolation from, or pathogenicity on, specific hosts. Currently, whole-genome comparisons are sensitive enough to identify unique traits in genetically close pathogens, such as the Xt-I clade (Goettelmann et al. 2022). Whole-genome analysis will avoid bacterial characterization based on a host of isolation and accurately identify isolates based on comparative phylogenomics.

In this study, we developed a genome-driven and lifestyle-informed pipeline to differentiate relevant cereal pathogens Xtt and Xtu using a multiplex PCR. We tested and confirmed the specificity of the X. translucens multiplex PCR primers with non-Xanthomonas spp., Xanthomonas spp., and X. translucens pathovars derived from pure cultures and from bacteria isolated from symptomatic leaf tissue collected from barley fields. From the field samples, we isolated X. hortorum, which has been detected in wheat and barley seeds (Egorova et al. 2014). This suggest that barley leaves can be a reservoir for other Xanthomonas species, and accurate diagnostic tools are necessary to avoid false positives or wrong disease assessment.

To our knowledge, this is the first multiplex PCR that differentiates Xtu and Xtt. We recognize that further analyses are necessary to improve the X. translucens multiplex PCR, such as sensitivity, limit of detection, testing a wide range and more numbers of Xt strains, and using plant tissue directly from the field. However, we achieved our goal to provide a resource for X. translucens pathovar identification, which was previously unavailable. Overall, our pipeline provides a novel, genome-based, and lifestyle-informed approach for accurate Xtt and Xtu identification. The multiplex PCR was independently validated by three laboratories, demonstrating that this tool is transferrable to other teams and researchers focused on X. translucens pathovar identification. This primer set can provide a clear and rapid tool for plant pathogen research and diagnostic labs, which could ultimately lead to improved cereal disease management strategies.

Acknowledgments

We thank the students William Shoaf and Zihang Gao for running some of the primer tests; Jan Leach at Colorado State University, Ralf Koebnik at The Institut de Recherche pour le Développement (IRD); and Sally Miller at The Ohio State University for sharing the bacterial strains used in this study.