First Report of Powdery Mildew on Verbascum thapsus Caused by Golovinomyces verbasci in the United States

Great mullein (Verbascum thapsus) is a biennial forb belonging to the family Scrophulariaceae. In Europe it is primarily cultivated as a medicinal herb. This plant is an invasive species across the United States that can grow more than 6 ft tall. The leaves are thick, leathery, and densely covered with hairs. In the fall of 2017, great mullein plants grown at the Pierce County Master Garden located at WSU Puyallup Research and Extension Center (47.2258°N, 122.4347°W) showed signs and symptoms of powdery mildew. The adaxial leaf surfaces were covered with white mycelia and conidia, whereas the abaxial surfaces were less infected. The hyphal appressoria were nipple shaped, and the foot cells of the conidiophores measured 216 × 12 μm. Conidia were borne in chains with as many as five conidia per chain. They were hyaline, elliptical, and had no fibrosin bodies. They (n = 52) ranged from 29 to 42 μm long (average = 38 μm) and 16 to 27 μm wide (average = 21 μm). Chasmothecia were not observed. These features were consistent with those of Golovinomyces verbasci as described in Braun and Cook (2012). To confirm the identification, the complete internal transcribed spacer (ITS) region and the 5′ end of the large subunit rDNA containing D1, D2, and D3 were amplified using the primers ITS₁-F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and TW₁₄ (GCTATCCTGAGGGAAACTTC) (Hamby et al. 1988) and deposited into GenBank (accession no. MF 972905). The 684-bp amplicon had 99% homology with two sequences of G. verbasci (accession nos. AB 769469.1 and AB769468) from Lithuania and Japan. Pathogenicity was confirmed through inoculation by gently pressing diseased leaves onto leaves of healthy V. thapsus plants. Five leaves per plant (three plants and a total of 15 leaves) were inoculated. The same number of leaves, maintained at room temperature, were used as a control without inoculation. Fifteen days after inoculation, symptoms and signs of powdery mildew developed on inoculated leaves. No symptoms developed on the leaves used as a control. The conidial morphology of the fungus that developed on inoculated plants was identical to the original fungus. To our knowledge, this is the first unequivocal report of G. verbasci on any host, including V. thapsus, in the United States (Farr and Rossman 2016). In many states great mullein is considered a noxious weed, making this information important for the U.S. Department of Ecology and the U.S. agriculture industry. It is also important for the horticulture industry, where this plant is grown and sold across the United States.